1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bixtya [17]
3 years ago
10

A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes t

he following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include
Biology
1 answer:
wel3 years ago
8 0

Answer:  Identify the promoter and the stop signal (terminator).

Explanation:

DNA is a molecule that contains the genetic information in all living things. This information is used for the synthesis of proteins that make up the body and carry out vital functions of the organism.

The DNA molecule consists of two strands that wind around each other to form a double helix structure, where each strand has a central part formed by sugars (deoxyribose in the case of DNA) and phosphate groups. The four basic components of DNA are nucleotides: adenine (A), thymine (T), guanine (G) and cytosine (C). The nucleotides are joined together (A to T and G to C) by chemical bonds and form base pairs that connect the two strands of DNA. Depending on the sequence of nucleotides (which have different bases), different proteins are synthesized.

<u>DNA replication consists of synthesizing another identical DNA molecule, using enzymes called polymerases, which are molecules specifically dedicated only to copy DNA. Transcription, on the other hand, is the process by which a copy of messenger RNA (mRNA) is generated from the sequence of a gene in the DNA. </u>This RNA molecule leaves the cell nucleus and enters the cytoplasm, where it directs protein synthesis (a polymer made up of many amino acids).

<u>Protein synthesis, or translation, involves translating the sequence of an mRNA molecule into an amino acid sequence during protein synthesis.</u> The genetic code describes the relationship between the sequence of base pairs in a gene and the corresponding sequence of amino acids it encodes. To begin translation, a start codon (set of 3 bases) must first be identified, which is usually AUG that also codes for the amino acid methionine. Then, the codons that follow are read and the corresponding amino acids are added according to the genetic code. The transfer RNA (tRNA) is complementary to the anticodon at specific codons in the messenger RNA and carries the amino acid coding for the codon. In addition, ribosomal RNA (rRNA) is an RNA that is part of ribosomes and is essential for protein synthesis in all living things. rRNAs form the framework of ribosomes and associate with specific proteins to form ribosomal pre-subunits. To finish the translation, a termination codon has to be read, which can be UGA, UAG or UAA.

To revise the model to show transcription to form mRNA, the research should identify the promoter and the stop signal. The promoter is a DNA sequence required to turn a gene on or off. The transcription process starts at the promoter which is usually located near the beginning of a gene and has a binding site for the enzyme that is used to make a messenger RNA (mRNA) molecule. The enzyme RNA polymerase will keep doing the transcription until it reaches a sequence of DNA that is signal which indicates it should stop. This process is called termination, and it happens once the enzyme reaches this sequence, called terminator.

You might be interested in
You have been asked to lead a research team to observe gorillas in their natural environment, collect DNA samples, and analyze h
defon

Answer:

As i am asked to lead a research team to observe gorillas in their natural environment I will prefer a team having persons expert in having knowledge of forest in which we are doing research on gorillas. They must be experience in working with gorillas and familiar with their nature.

My team should have a person who know to use the tranquilizer gun because to collect the DNA sample gorilla needs to be tranquilized. My team should have one veterinary doctor who can examine the animal and take the DNA sample.

People with Good communication skills, observation skills and critical thinking skills are required in the team to successfully complete the research.

8 0
4 years ago
Which best describes red blood cells?
sesenic [268]
Answer: C. They transport oxygen throughout the body.
It is the primary function of red blood cells.

Hope it helped!
4 0
3 years ago
Read 2 more answers
Which group of words are energy sources for muscles?
devlian [24]
I would say D. Osteoarthritis, presbyopia 
7 0
4 years ago
Disadvantage of community service?
Hitman42 [59]

Answer:

you don't earn money while volunteering

volunteering aboard can be expensive

many volunteers have too high expectations

Explanation:

I searched it up and took time to read

5 0
3 years ago
Help with answering this question!
svlad2 [7]

Answer:

coyote and jackal

Explanation:

branches are closer together on the tree

5 0
3 years ago
Other questions:
  • What role does the endomembrane play
    9·1 answer
  • During ketogenesis, the liver synthesizes ketone bodies that can be used as an energy source. Put the following statements regar
    6·1 answer
  • All chordates have _____ (at some point in their life cycle). feathers diaphragm fins pharyngeal pouches
    14·1 answer
  • The modification of proteins occur in which organelle of the cell ...?
    15·1 answer
  • Which kind of cell membrane protein changes shape as it transports substances from one side of the cell membrane to the other?
    9·1 answer
  • What difference between slow twitch and fast twitch muscle fibers relates most to their difference in function?
    14·2 answers
  • How is tertiary structure maintained?
    11·1 answer
  • How does the Doppler effect change the appearance of emitted light?
    9·1 answer
  • Anyone here let's ch.at na yrr...What is the impact of world war 2​
    7·1 answer
  • Need it now 100 points
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!