1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bixtya [17]
3 years ago
10

A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes t

he following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include
Biology
1 answer:
wel3 years ago
8 0

Answer:  Identify the promoter and the stop signal (terminator).

Explanation:

DNA is a molecule that contains the genetic information in all living things. This information is used for the synthesis of proteins that make up the body and carry out vital functions of the organism.

The DNA molecule consists of two strands that wind around each other to form a double helix structure, where each strand has a central part formed by sugars (deoxyribose in the case of DNA) and phosphate groups. The four basic components of DNA are nucleotides: adenine (A), thymine (T), guanine (G) and cytosine (C). The nucleotides are joined together (A to T and G to C) by chemical bonds and form base pairs that connect the two strands of DNA. Depending on the sequence of nucleotides (which have different bases), different proteins are synthesized.

<u>DNA replication consists of synthesizing another identical DNA molecule, using enzymes called polymerases, which are molecules specifically dedicated only to copy DNA. Transcription, on the other hand, is the process by which a copy of messenger RNA (mRNA) is generated from the sequence of a gene in the DNA. </u>This RNA molecule leaves the cell nucleus and enters the cytoplasm, where it directs protein synthesis (a polymer made up of many amino acids).

<u>Protein synthesis, or translation, involves translating the sequence of an mRNA molecule into an amino acid sequence during protein synthesis.</u> The genetic code describes the relationship between the sequence of base pairs in a gene and the corresponding sequence of amino acids it encodes. To begin translation, a start codon (set of 3 bases) must first be identified, which is usually AUG that also codes for the amino acid methionine. Then, the codons that follow are read and the corresponding amino acids are added according to the genetic code. The transfer RNA (tRNA) is complementary to the anticodon at specific codons in the messenger RNA and carries the amino acid coding for the codon. In addition, ribosomal RNA (rRNA) is an RNA that is part of ribosomes and is essential for protein synthesis in all living things. rRNAs form the framework of ribosomes and associate with specific proteins to form ribosomal pre-subunits. To finish the translation, a termination codon has to be read, which can be UGA, UAG or UAA.

To revise the model to show transcription to form mRNA, the research should identify the promoter and the stop signal. The promoter is a DNA sequence required to turn a gene on or off. The transcription process starts at the promoter which is usually located near the beginning of a gene and has a binding site for the enzyme that is used to make a messenger RNA (mRNA) molecule. The enzyme RNA polymerase will keep doing the transcription until it reaches a sequence of DNA that is signal which indicates it should stop. This process is called termination, and it happens once the enzyme reaches this sequence, called terminator.

You might be interested in
What is a tumor? *
Helen [10]

Answer:

i think it is.. a mass of cancer cells

Explanation:

3 0
3 years ago
Question 14
ipn [44]

Answer: Initially part of the flower will be blue and part will be red, but eventually both colors will appear in all parts of the flower.

Explanation:

4 0
3 years ago
Play I’m lazzzzyyyyyy
denis23 [38]
.......................
8 0
3 years ago
A nurse notes that the fev1/fvc ratio is less than 70% and the fev1 is 25% for a patient with copd. what stage should the nurse
disa [49]
Stage 3  because the person fev1 level is go down not up 
4 0
3 years ago
Which term describes this group of stars?<br> Moon<br> Solar System<br> Galaxy<br> Universe
Ganezh [65]

Answer:

I think Galaxy hope this help in anyway!

Explanation:

7 0
3 years ago
Other questions:
  • Cnidarians such as jellyfish have radial symmetry. how are the body parts of cnidarians arranged?
    14·2 answers
  • Which was the first cell viewed by the light microscope?
    8·2 answers
  • FREE POINTSSS AND BRAINLIEST just ask me some questions while I do my quiz and ask random questions I don’t care what they are o
    6·2 answers
  • Which of the following lists the steps of technological development in the
    13·2 answers
  • 2. This cell structure acts as the "brain" or command center for the cell.
    11·1 answer
  • HELP??????????????<br> ????
    10·1 answer
  • A group of the same species, living together and breeding is known as a ______________. community kingdom population
    14·2 answers
  • Gems called rubies are used in lasers.<br> Please select the best answer from the choices provided
    13·1 answer
  • ASAP GIVE BRAINLIEST- 100 points after answered
    5·1 answer
  • How are they different?<br> Giraffe
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!