1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bixtya [17]
3 years ago
10

A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes t

he following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include
Biology
1 answer:
wel3 years ago
8 0

Answer:  Identify the promoter and the stop signal (terminator).

Explanation:

DNA is a molecule that contains the genetic information in all living things. This information is used for the synthesis of proteins that make up the body and carry out vital functions of the organism.

The DNA molecule consists of two strands that wind around each other to form a double helix structure, where each strand has a central part formed by sugars (deoxyribose in the case of DNA) and phosphate groups. The four basic components of DNA are nucleotides: adenine (A), thymine (T), guanine (G) and cytosine (C). The nucleotides are joined together (A to T and G to C) by chemical bonds and form base pairs that connect the two strands of DNA. Depending on the sequence of nucleotides (which have different bases), different proteins are synthesized.

<u>DNA replication consists of synthesizing another identical DNA molecule, using enzymes called polymerases, which are molecules specifically dedicated only to copy DNA. Transcription, on the other hand, is the process by which a copy of messenger RNA (mRNA) is generated from the sequence of a gene in the DNA. </u>This RNA molecule leaves the cell nucleus and enters the cytoplasm, where it directs protein synthesis (a polymer made up of many amino acids).

<u>Protein synthesis, or translation, involves translating the sequence of an mRNA molecule into an amino acid sequence during protein synthesis.</u> The genetic code describes the relationship between the sequence of base pairs in a gene and the corresponding sequence of amino acids it encodes. To begin translation, a start codon (set of 3 bases) must first be identified, which is usually AUG that also codes for the amino acid methionine. Then, the codons that follow are read and the corresponding amino acids are added according to the genetic code. The transfer RNA (tRNA) is complementary to the anticodon at specific codons in the messenger RNA and carries the amino acid coding for the codon. In addition, ribosomal RNA (rRNA) is an RNA that is part of ribosomes and is essential for protein synthesis in all living things. rRNAs form the framework of ribosomes and associate with specific proteins to form ribosomal pre-subunits. To finish the translation, a termination codon has to be read, which can be UGA, UAG or UAA.

To revise the model to show transcription to form mRNA, the research should identify the promoter and the stop signal. The promoter is a DNA sequence required to turn a gene on or off. The transcription process starts at the promoter which is usually located near the beginning of a gene and has a binding site for the enzyme that is used to make a messenger RNA (mRNA) molecule. The enzyme RNA polymerase will keep doing the transcription until it reaches a sequence of DNA that is signal which indicates it should stop. This process is called termination, and it happens once the enzyme reaches this sequence, called terminator.

You might be interested in
Pure sugar is an example of a(n):
Vlad [161]
It is am example of a COMPOUND
6 0
3 years ago
Read 2 more answers
Consider the following DNA sequences for four different species: 1: AATCG 2: TAATG 3: ATACC 4: ATAGG Based on the principle of p
faltersainse [42]

Answer:

AATGG

Explanation:

bcz A is in pair with T and C is in pair with G.

3 0
3 years ago
Most animals with backbones, vertebrates, have a similar body plan: skull, ribs, two pairs of limbs, tail. What does this sugges
daser333 [38]

The correct answer is E. Vertebrates are all related to a common ancestor

Explanation:

According to biology and evolution, organisms from different species but that share similarities in morphology (body structures) as well as in genetics often have a phylogenetic relationship which means they descend from the same organism or share a common ancestor. This applies to multiple taxonomical levels including classes such as mammals or birds as it has been proved each of this derived from a common ancestor. Therefore, the similarity in the body structure (morphology) in all mammals suggest vertebrates are related to a common ancestor and as they evolved from this, they share similarities not only in terms of morphology but also in genetics.

3 0
3 years ago
Read 2 more answers
How are villi and alveoli similar?
Serjik [45]
Do not click the link
8 0
3 years ago
What do chicken pox, measles, polio and influenza all have in common?
Anton [14]
B~ All caused by viruses
6 0
3 years ago
Other questions:
  • Annelids skeleton, Endoskeleton, Exoskeleton, or None? FIRST ANSWER BRAINLEST!!!!!
    11·1 answer
  • Which best explains the importance of a selectively permeable cell
    14·1 answer
  • Que es anatomía y fisiología <br><br>​
    10·1 answer
  • What is the name of the energy containing molecule created by cellular respiration
    12·1 answer
  • Nausea and vomiting are common complaints during pregnancy. what nutritional action can be used to lessen nausea and vomiting?
    6·1 answer
  • Which of the following is relatively constant in an ecosystem? More than one answer may be correct!
    13·2 answers
  • Some factors in a particular ecosystem include: sunlight, alfalfa, rabbits, hawks, and mice. Of these factors, which one is the
    10·2 answers
  • Water is transpired through stomata, but carbon dioxide also must pass through stomata into a leaf for photosynthesis to occur.
    5·1 answer
  • Help me plssss thanksssssssssssss.
    13·2 answers
  • __ refers to an inheritance pattern where there is more than one dominant allele that can be expressed at the same time.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!