1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bixtya [17]
3 years ago
10

A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes t

he following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include
Biology
1 answer:
wel3 years ago
8 0

Answer:  Identify the promoter and the stop signal (terminator).

Explanation:

DNA is a molecule that contains the genetic information in all living things. This information is used for the synthesis of proteins that make up the body and carry out vital functions of the organism.

The DNA molecule consists of two strands that wind around each other to form a double helix structure, where each strand has a central part formed by sugars (deoxyribose in the case of DNA) and phosphate groups. The four basic components of DNA are nucleotides: adenine (A), thymine (T), guanine (G) and cytosine (C). The nucleotides are joined together (A to T and G to C) by chemical bonds and form base pairs that connect the two strands of DNA. Depending on the sequence of nucleotides (which have different bases), different proteins are synthesized.

<u>DNA replication consists of synthesizing another identical DNA molecule, using enzymes called polymerases, which are molecules specifically dedicated only to copy DNA. Transcription, on the other hand, is the process by which a copy of messenger RNA (mRNA) is generated from the sequence of a gene in the DNA. </u>This RNA molecule leaves the cell nucleus and enters the cytoplasm, where it directs protein synthesis (a polymer made up of many amino acids).

<u>Protein synthesis, or translation, involves translating the sequence of an mRNA molecule into an amino acid sequence during protein synthesis.</u> The genetic code describes the relationship between the sequence of base pairs in a gene and the corresponding sequence of amino acids it encodes. To begin translation, a start codon (set of 3 bases) must first be identified, which is usually AUG that also codes for the amino acid methionine. Then, the codons that follow are read and the corresponding amino acids are added according to the genetic code. The transfer RNA (tRNA) is complementary to the anticodon at specific codons in the messenger RNA and carries the amino acid coding for the codon. In addition, ribosomal RNA (rRNA) is an RNA that is part of ribosomes and is essential for protein synthesis in all living things. rRNAs form the framework of ribosomes and associate with specific proteins to form ribosomal pre-subunits. To finish the translation, a termination codon has to be read, which can be UGA, UAG or UAA.

To revise the model to show transcription to form mRNA, the research should identify the promoter and the stop signal. The promoter is a DNA sequence required to turn a gene on or off. The transcription process starts at the promoter which is usually located near the beginning of a gene and has a binding site for the enzyme that is used to make a messenger RNA (mRNA) molecule. The enzyme RNA polymerase will keep doing the transcription until it reaches a sequence of DNA that is signal which indicates it should stop. This process is called termination, and it happens once the enzyme reaches this sequence, called terminator.

You might be interested in
Please help me clearly 25 points mateee!!
Leona [35]

3. IV:height of drop DV:height of bounce CV: type of ball, place where ball is dropped, climate/wind

4. IV: battery type DV: time that it lasts CV: age of batteries, age of material (flashlights), type of materials (flashlights), size of batteries

5. IV:depth of water DV: temperature CV: amount of water in lake, temperature, climate/season


4 0
3 years ago
Plz idk if it’s correct
kap26 [50]

Answer:

Yes you are correct.

Explanation:

Number one is the rough ER not the nucleus. Number 3 is the mitochondria not the Ribosomes. This is an animal cell so there can not be a cell wall. There are exactly 3 small vacuoles in an animal cell so yes, you are correct.

3 0
3 years ago
Read 2 more answers
Shouldn't this be respiration and photosynthesis not as its spelled here?
Rus_ich [418]
Please rephrase the question, it doesn't make sense.

5 0
4 years ago
What information did you include in your
Arturiano [62]

Answer:

It contains all of the instructions a cell needs to sustain itself. These instructions are found within genes, which are sections of DNA made ... form that can be used by cells to produce the proteins needed to support life. ... In other cases, the RNA molecule carries messages from the DNA to other parts of the cell for processing.

Explanation:

7 0
3 years ago
Pls help me with this it’s worth 10 points!!!
MArishka [77]

the controlled variables are, timing of adding ice, water used, and amount of sugar. the dependant variables are, daily temperature, and amount of lemon juice. the independent variable is, number of glasses sold. hope it helps

please mark brainlyist

3 0
3 years ago
Other questions:
  • The ability to change body position and direction quickly and efficiently defines what skill
    15·1 answer
  • What are three factors tht make a rock susceptible to weathering
    7·1 answer
  • What makes water a polar molecule?
    5·1 answer
  • Primary producers are organisms that?
    15·2 answers
  • Which of the following terms describes a set of chemical reactions used by the cell to build up and break down molecules necessa
    9·2 answers
  • Why is the demand for environmental scientists and specialists expected to increase?
    12·2 answers
  • How does the fermentation of pyruvic acid in cells contribute to the formation of ATP? A. It completes the oxidation of glucose
    5·2 answers
  • How can I make a 3-D brain model ?​
    5·2 answers
  • Identify the cause of impure groundwater.
    14·1 answer
  • Which property of a substance can be determined using a pH indicator? A acidity B. boiling point. C density D. electrical conduc
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!