1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bixtya [17]
3 years ago
10

A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes t

he following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include
Biology
1 answer:
wel3 years ago
8 0

Answer:  Identify the promoter and the stop signal (terminator).

Explanation:

DNA is a molecule that contains the genetic information in all living things. This information is used for the synthesis of proteins that make up the body and carry out vital functions of the organism.

The DNA molecule consists of two strands that wind around each other to form a double helix structure, where each strand has a central part formed by sugars (deoxyribose in the case of DNA) and phosphate groups. The four basic components of DNA are nucleotides: adenine (A), thymine (T), guanine (G) and cytosine (C). The nucleotides are joined together (A to T and G to C) by chemical bonds and form base pairs that connect the two strands of DNA. Depending on the sequence of nucleotides (which have different bases), different proteins are synthesized.

<u>DNA replication consists of synthesizing another identical DNA molecule, using enzymes called polymerases, which are molecules specifically dedicated only to copy DNA. Transcription, on the other hand, is the process by which a copy of messenger RNA (mRNA) is generated from the sequence of a gene in the DNA. </u>This RNA molecule leaves the cell nucleus and enters the cytoplasm, where it directs protein synthesis (a polymer made up of many amino acids).

<u>Protein synthesis, or translation, involves translating the sequence of an mRNA molecule into an amino acid sequence during protein synthesis.</u> The genetic code describes the relationship between the sequence of base pairs in a gene and the corresponding sequence of amino acids it encodes. To begin translation, a start codon (set of 3 bases) must first be identified, which is usually AUG that also codes for the amino acid methionine. Then, the codons that follow are read and the corresponding amino acids are added according to the genetic code. The transfer RNA (tRNA) is complementary to the anticodon at specific codons in the messenger RNA and carries the amino acid coding for the codon. In addition, ribosomal RNA (rRNA) is an RNA that is part of ribosomes and is essential for protein synthesis in all living things. rRNAs form the framework of ribosomes and associate with specific proteins to form ribosomal pre-subunits. To finish the translation, a termination codon has to be read, which can be UGA, UAG or UAA.

To revise the model to show transcription to form mRNA, the research should identify the promoter and the stop signal. The promoter is a DNA sequence required to turn a gene on or off. The transcription process starts at the promoter which is usually located near the beginning of a gene and has a binding site for the enzyme that is used to make a messenger RNA (mRNA) molecule. The enzyme RNA polymerase will keep doing the transcription until it reaches a sequence of DNA that is signal which indicates it should stop. This process is called termination, and it happens once the enzyme reaches this sequence, called terminator.

You might be interested in
Explain the 1st and 2nd law of thermodynamics in terms of food chain, energy flow, pyramid of number and pyramid of energy
Westkost [7]

Answer:

First law of thermodynamics is the conservation of energy states that energy is not created and not destroyed but only can be stored.

Thermodynamics second law states that total entropy of a system increases from lower to higher system and some of the energy is always wasted during the work done.

In the food chain plants are the producers which accept light energy and stored in the form of chemical energy and energy flow to the herbivores and higher trophic levels in the chemical form only and no new energy is created in between the chain (Fisrt law of thermodynamics). Heat is generated during respiration by plants and animals (wasted energy) and entropy also increases with the increase in level of the pyramid of energy (Second law of thermodynamics).

4 0
3 years ago
Sections in the crust bend sharply to form mountains as a result of sections in the crust bend sharply to form mountains as a re
attashe74 [19]
An uplift from earths crust
8 0
3 years ago
Water vapor in the air forms clouds because the air can no longer hold the water vapor as it _____.
pantera1 [17]

The answer is; B

As air cools, its capacity to hold moisture reduces. This is is why as warm humid air cools, it reaches a saturation point, and the water moisture begins to form droplets. These droplets form clouds in the atmosphere.


5 0
3 years ago
One reason native plants are declining is that the invasive plants absorb nitrogen from the soil about twice as fast (α = 2). Ho
Dmitry_Shevchenko [17]

Answer:

α = 0 if β= 0

Explanation:

If both species want to persist in the same environment and their niches are also over lapping then both of the co-efficient values should be equal. There are two possibilities on these values for persistence. One is that one should compromise to the change produced by the invasive specie and two is that the new specie should compromise if he wants to stay (<em><u>Assuming that there is no competition</u></em>). In this way their niches won't overlap to a greater extent and therefore better chances of survival for both.

3 0
3 years ago
Meiosis consists of cell divisions with only one duplication of . this division results in daughter cells, each with set of chro
ale4655 [162]

SOS:

The answer is

  • <u><em>Two</em></u>
  • <u><em>Chromosomes</em></u>
  • <u><em>Four</em></u>
  • <u><em>One </em></u>
  • <u><em>Haploid</em></u>

<em>Hope this helps!</em>

6 0
3 years ago
Other questions:
  • Please take time to look ! Some of the oldest cells in the human body are found in the(1 point) colon. liver. heart. skin.
    6·2 answers
  • What are some steps that scientist can take in designing an experiment to avoid false negatives
    12·2 answers
  • What determines the inherited traits an organism has?
    12·2 answers
  • Example of omnivores<br>​​​
    7·2 answers
  • Which of the following is not true of biotechnology? Biotechnology raises just as many concerns as it does benefits. Biotechnolo
    12·1 answer
  • A deficiency of this vitamin is very rare, but those with inadequate intakes can experience numbness, muscle cramps, and difficu
    6·1 answer
  • Yo can someone help me out
    6·2 answers
  • Surface features that affect climate
    7·1 answer
  • Which of the following sentences from the article helps prove the claim that living with farm animals can help prevent asthma?
    15·2 answers
  • Predict what happen to the human and the plants if the transport system are affected​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!