1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bixtya [17]
3 years ago
10

A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes t

he following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include
Biology
1 answer:
wel3 years ago
8 0

Answer:  Identify the promoter and the stop signal (terminator).

Explanation:

DNA is a molecule that contains the genetic information in all living things. This information is used for the synthesis of proteins that make up the body and carry out vital functions of the organism.

The DNA molecule consists of two strands that wind around each other to form a double helix structure, where each strand has a central part formed by sugars (deoxyribose in the case of DNA) and phosphate groups. The four basic components of DNA are nucleotides: adenine (A), thymine (T), guanine (G) and cytosine (C). The nucleotides are joined together (A to T and G to C) by chemical bonds and form base pairs that connect the two strands of DNA. Depending on the sequence of nucleotides (which have different bases), different proteins are synthesized.

<u>DNA replication consists of synthesizing another identical DNA molecule, using enzymes called polymerases, which are molecules specifically dedicated only to copy DNA. Transcription, on the other hand, is the process by which a copy of messenger RNA (mRNA) is generated from the sequence of a gene in the DNA. </u>This RNA molecule leaves the cell nucleus and enters the cytoplasm, where it directs protein synthesis (a polymer made up of many amino acids).

<u>Protein synthesis, or translation, involves translating the sequence of an mRNA molecule into an amino acid sequence during protein synthesis.</u> The genetic code describes the relationship between the sequence of base pairs in a gene and the corresponding sequence of amino acids it encodes. To begin translation, a start codon (set of 3 bases) must first be identified, which is usually AUG that also codes for the amino acid methionine. Then, the codons that follow are read and the corresponding amino acids are added according to the genetic code. The transfer RNA (tRNA) is complementary to the anticodon at specific codons in the messenger RNA and carries the amino acid coding for the codon. In addition, ribosomal RNA (rRNA) is an RNA that is part of ribosomes and is essential for protein synthesis in all living things. rRNAs form the framework of ribosomes and associate with specific proteins to form ribosomal pre-subunits. To finish the translation, a termination codon has to be read, which can be UGA, UAG or UAA.

To revise the model to show transcription to form mRNA, the research should identify the promoter and the stop signal. The promoter is a DNA sequence required to turn a gene on or off. The transcription process starts at the promoter which is usually located near the beginning of a gene and has a binding site for the enzyme that is used to make a messenger RNA (mRNA) molecule. The enzyme RNA polymerase will keep doing the transcription until it reaches a sequence of DNA that is signal which indicates it should stop. This process is called termination, and it happens once the enzyme reaches this sequence, called terminator.

You might be interested in
6. Lactic acid is a byproduct
Sauron [17]

Answer:

-Anaerobic Respiration

Explanation:

The waste byproduct

6 0
3 years ago
We can classify both the shovel and the garden trowel as compound machines. This is because each garden tool contains two simple
Butoxors [25]

A) - a lever and a wedge

3 0
3 years ago
Read 2 more answers
How does a painkiller work?
Jlenok [28]

a painkiller once ingested sends a type of sedative through your body which eventually reaches your brain which sends signals to your nervous system causing the irritated nerves to become less and less irritated. the reason they take so long to kick in is because they have to work through your body via the bloodstream

hope this helps :) ❤❤❤❤❤❤❤❤❤❤❤❤❤❤❤❤❤❤❤❤

4 0
3 years ago
What can happen when earth materials overcome the force of friction holding them together?
tia_tia [17]
I would say landslide because it does cause because of the lost of friction.
7 0
3 years ago
Read 2 more answers
Why are archaea in a different domain from bacteria apex?
mariarad [96]
The archaea are in a different domain from bacteria due to certain differences in their morphology and habitats, the Archaea are the separate domain of life in prokaryotes. For example; unlike bacteria, archaea cell walls do not contain peptidoglycan, they have different membrane lipid bonding from bacteria and eukarya.
Archaea is  considered as the different domain of life in prokaryotes, as they are the most primitive type and known as the ancient microbes found in extreme niches such as hydrothermal vents, higher salt concentration, high temperature, and pressure etc
3 0
3 years ago
Read 2 more answers
Other questions:
  • What basic unit of heredity is found on segments of DNA and are passed on from parent to offspring? nucleotide gene phosphate mo
    8·2 answers
  • Do <img src="https://tex.z-dn.net/?f=CO_2" id="TexFormula1" title="CO_2" alt="CO_2" align="absmiddle" class="latex-formula"> is
    10·1 answer
  • Which of the following gives rise to the skin cells?
    15·1 answer
  • A bond formed by the electrical attraction between two oppositely charged ions is a(n)_____.
    6·2 answers
  • What important trait do all Protists share
    7·1 answer
  • What are the locations in the cell cycle where proteins can initiate or stop the next phase of the cycle called?
    13·1 answer
  • If the organisms at level 2 were to decrease, explain what would happen to 6 points
    15·1 answer
  • The area of soil in which the pores are totally filled with water is called the ____________________ zone.
    7·2 answers
  • What is the genotype ratio?
    11·1 answer
  • Candy ke lie suitable title
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!