1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bixtya [17]
3 years ago
10

A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes t

he following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include
Biology
1 answer:
wel3 years ago
8 0

Answer:  Identify the promoter and the stop signal (terminator).

Explanation:

DNA is a molecule that contains the genetic information in all living things. This information is used for the synthesis of proteins that make up the body and carry out vital functions of the organism.

The DNA molecule consists of two strands that wind around each other to form a double helix structure, where each strand has a central part formed by sugars (deoxyribose in the case of DNA) and phosphate groups. The four basic components of DNA are nucleotides: adenine (A), thymine (T), guanine (G) and cytosine (C). The nucleotides are joined together (A to T and G to C) by chemical bonds and form base pairs that connect the two strands of DNA. Depending on the sequence of nucleotides (which have different bases), different proteins are synthesized.

<u>DNA replication consists of synthesizing another identical DNA molecule, using enzymes called polymerases, which are molecules specifically dedicated only to copy DNA. Transcription, on the other hand, is the process by which a copy of messenger RNA (mRNA) is generated from the sequence of a gene in the DNA. </u>This RNA molecule leaves the cell nucleus and enters the cytoplasm, where it directs protein synthesis (a polymer made up of many amino acids).

<u>Protein synthesis, or translation, involves translating the sequence of an mRNA molecule into an amino acid sequence during protein synthesis.</u> The genetic code describes the relationship between the sequence of base pairs in a gene and the corresponding sequence of amino acids it encodes. To begin translation, a start codon (set of 3 bases) must first be identified, which is usually AUG that also codes for the amino acid methionine. Then, the codons that follow are read and the corresponding amino acids are added according to the genetic code. The transfer RNA (tRNA) is complementary to the anticodon at specific codons in the messenger RNA and carries the amino acid coding for the codon. In addition, ribosomal RNA (rRNA) is an RNA that is part of ribosomes and is essential for protein synthesis in all living things. rRNAs form the framework of ribosomes and associate with specific proteins to form ribosomal pre-subunits. To finish the translation, a termination codon has to be read, which can be UGA, UAG or UAA.

To revise the model to show transcription to form mRNA, the research should identify the promoter and the stop signal. The promoter is a DNA sequence required to turn a gene on or off. The transcription process starts at the promoter which is usually located near the beginning of a gene and has a binding site for the enzyme that is used to make a messenger RNA (mRNA) molecule. The enzyme RNA polymerase will keep doing the transcription until it reaches a sequence of DNA that is signal which indicates it should stop. This process is called termination, and it happens once the enzyme reaches this sequence, called terminator.

You might be interested in
How to determine the enzymes used to cut plasmid in cloning.
Alex73 [517]
When cloning by restriction digest and ligation, you use restriction enzymes to cut open a plasmid (backbone) and insert a linear fragment of DNA (insert) that has been cut by compatible restriction enzymes. An enzyme, DNA ligase, then covalently binds the plasmid to the new fragment thereby generating a complete, circular plasmid that can be easily maintained in a variety of biological systems. Read on for an in-depth breakdown of how to do perform restriction digests.
8 0
3 years ago
What is the difference between endocytosis and exocytosis
wariber [46]
Endocytosis is when a a cell engulfs material into the cell and exocytosis a form of waste where the cell gets rid of materials.
7 0
3 years ago
Read 2 more answers
Which of the following mush an animal do to survive?!
-Dominant- [34]
They must find food 
they must find shelter 

3 0
3 years ago
Which of the processes of the water cycle car by releasing energy?
arsen [322]
Condensation, because when water vapor turns into water again it needs to release energy to do so. Its like turning ice into water again. 

I hope this helped ^_^
3 0
3 years ago
The base of a pyramid is built from organisms that primarily
leonid [27]

Answer:

Autotrophs

Explanation:

6 0
3 years ago
Other questions:
  • Disease-causing agents, called ________, are found throughout the world.
    15·1 answer
  • Greater biodiversity exists closer to earths equator then in areas closer to earths poles
    13·1 answer
  • Should killer whales be kept in marine parks be free in the wild wikipedia
    5·1 answer
  • Which type of pyramid shows the amount of living tissue at each trophic level in an ecosystem
    8·1 answer
  • In an experiment, what is the factor that is tested? control specimen hypothesis variable
    9·1 answer
  • You maintain internal body temperature through negative feedback mechanism. Which of the following is a response to decrease bod
    14·1 answer
  • Which is one climate that is characterized as having many trees?
    6·2 answers
  • Which weighs less regular soda or diet soda?
    10·2 answers
  • The suncoast tree of northwest Africa is known for 2 traits that are said to show simple dominance. The 2 traits are height and
    11·1 answer
  • What is the largest bone in the human body?​
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!