1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bixtya [17]
3 years ago
10

A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes t

he following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include
Biology
1 answer:
wel3 years ago
8 0

Answer:  Identify the promoter and the stop signal (terminator).

Explanation:

DNA is a molecule that contains the genetic information in all living things. This information is used for the synthesis of proteins that make up the body and carry out vital functions of the organism.

The DNA molecule consists of two strands that wind around each other to form a double helix structure, where each strand has a central part formed by sugars (deoxyribose in the case of DNA) and phosphate groups. The four basic components of DNA are nucleotides: adenine (A), thymine (T), guanine (G) and cytosine (C). The nucleotides are joined together (A to T and G to C) by chemical bonds and form base pairs that connect the two strands of DNA. Depending on the sequence of nucleotides (which have different bases), different proteins are synthesized.

<u>DNA replication consists of synthesizing another identical DNA molecule, using enzymes called polymerases, which are molecules specifically dedicated only to copy DNA. Transcription, on the other hand, is the process by which a copy of messenger RNA (mRNA) is generated from the sequence of a gene in the DNA. </u>This RNA molecule leaves the cell nucleus and enters the cytoplasm, where it directs protein synthesis (a polymer made up of many amino acids).

<u>Protein synthesis, or translation, involves translating the sequence of an mRNA molecule into an amino acid sequence during protein synthesis.</u> The genetic code describes the relationship between the sequence of base pairs in a gene and the corresponding sequence of amino acids it encodes. To begin translation, a start codon (set of 3 bases) must first be identified, which is usually AUG that also codes for the amino acid methionine. Then, the codons that follow are read and the corresponding amino acids are added according to the genetic code. The transfer RNA (tRNA) is complementary to the anticodon at specific codons in the messenger RNA and carries the amino acid coding for the codon. In addition, ribosomal RNA (rRNA) is an RNA that is part of ribosomes and is essential for protein synthesis in all living things. rRNAs form the framework of ribosomes and associate with specific proteins to form ribosomal pre-subunits. To finish the translation, a termination codon has to be read, which can be UGA, UAG or UAA.

To revise the model to show transcription to form mRNA, the research should identify the promoter and the stop signal. The promoter is a DNA sequence required to turn a gene on or off. The transcription process starts at the promoter which is usually located near the beginning of a gene and has a binding site for the enzyme that is used to make a messenger RNA (mRNA) molecule. The enzyme RNA polymerase will keep doing the transcription until it reaches a sequence of DNA that is signal which indicates it should stop. This process is called termination, and it happens once the enzyme reaches this sequence, called terminator.

You might be interested in
Dr. kitty hauke is studying lobsters in maine. she noticed that over several years the average length of pincers had increased w
zimovet [89]
I believe if her hypothesis was incorrect the percentage of the large lobsters with large pincers would decrease. The large pincers help the lobsters to quickly catch their pray efficiently. This would mean the survival of the lobsters with large pincers. A wrong hypothesis would mean that the large pincer lobsters would die and decrease in number. 
4 0
4 years ago
Read 2 more answers
What kingdom does a sunflower belong to
harkovskaia [24]
The sunflower belongs to the Plantae kingdom
8 0
3 years ago
Which of the following is a non timber forest product?
k0ka [10]

The correct answer C. Charcoal.

Timber products sets the standard for the quality of product, environment stewardship and innovation.

Timber products are known to be the largest supplier of domestic cabinet.

Some of the quality products include panels, veneers, components, hardwood lumber, particle board, and laminates.

3 0
3 years ago
Read 2 more answers
Question 6 of 10
kobusy [5.1K]

Answer:

a a a a a a a a a a. a aa aaaaaaaaa a a a

8 0
3 years ago
Potential energy stored in bonds is released as ________ energy.
IRISSAK [1]
I believe it is Covalent?
3 0
3 years ago
Other questions:
  • How will increasing the mutation rate affect evolution?
    7·1 answer
  • Automobiles cause air pollution when they burn gasoline. Laws have been passed to make automobile manufacturers limit the amount
    7·1 answer
  • Which organic compounds (carbohydrates, lipids, proteins, or nucleic acids) make up
    7·1 answer
  • The secondary sex characteristics of the male are controlled by hormones produced by what
    10·2 answers
  • Explain why programmed cell death (apoptosis) is important.
    10·1 answer
  • The surgical procedure that inserts a plastic tube from the ventricle of the brain to the peritoneal cavity to continuously remo
    10·1 answer
  • Did the employer use an incentive program to retaliate against Doug?
    14·1 answer
  • 3. What distance, will a car traveling 65km/hr travel in 3 hours?
    14·1 answer
  • Hi hlo I am beginner plz some teach me to use this app​
    11·1 answer
  • Where are earthquakes most likely to
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!