1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bixtya [17]
3 years ago
10

A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes t

he following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include
Biology
1 answer:
wel3 years ago
8 0

Answer:  Identify the promoter and the stop signal (terminator).

Explanation:

DNA is a molecule that contains the genetic information in all living things. This information is used for the synthesis of proteins that make up the body and carry out vital functions of the organism.

The DNA molecule consists of two strands that wind around each other to form a double helix structure, where each strand has a central part formed by sugars (deoxyribose in the case of DNA) and phosphate groups. The four basic components of DNA are nucleotides: adenine (A), thymine (T), guanine (G) and cytosine (C). The nucleotides are joined together (A to T and G to C) by chemical bonds and form base pairs that connect the two strands of DNA. Depending on the sequence of nucleotides (which have different bases), different proteins are synthesized.

<u>DNA replication consists of synthesizing another identical DNA molecule, using enzymes called polymerases, which are molecules specifically dedicated only to copy DNA. Transcription, on the other hand, is the process by which a copy of messenger RNA (mRNA) is generated from the sequence of a gene in the DNA. </u>This RNA molecule leaves the cell nucleus and enters the cytoplasm, where it directs protein synthesis (a polymer made up of many amino acids).

<u>Protein synthesis, or translation, involves translating the sequence of an mRNA molecule into an amino acid sequence during protein synthesis.</u> The genetic code describes the relationship between the sequence of base pairs in a gene and the corresponding sequence of amino acids it encodes. To begin translation, a start codon (set of 3 bases) must first be identified, which is usually AUG that also codes for the amino acid methionine. Then, the codons that follow are read and the corresponding amino acids are added according to the genetic code. The transfer RNA (tRNA) is complementary to the anticodon at specific codons in the messenger RNA and carries the amino acid coding for the codon. In addition, ribosomal RNA (rRNA) is an RNA that is part of ribosomes and is essential for protein synthesis in all living things. rRNAs form the framework of ribosomes and associate with specific proteins to form ribosomal pre-subunits. To finish the translation, a termination codon has to be read, which can be UGA, UAG or UAA.

To revise the model to show transcription to form mRNA, the research should identify the promoter and the stop signal. The promoter is a DNA sequence required to turn a gene on or off. The transcription process starts at the promoter which is usually located near the beginning of a gene and has a binding site for the enzyme that is used to make a messenger RNA (mRNA) molecule. The enzyme RNA polymerase will keep doing the transcription until it reaches a sequence of DNA that is signal which indicates it should stop. This process is called termination, and it happens once the enzyme reaches this sequence, called terminator.

You might be interested in
Can either a genotype or phenotype be expressed as a percentage?​
Readme [11.4K]

Answer:

Phenotype

Explanation:

"only four phenotypes result from the six possible ABO genotypes. How does this happen? To understand why this occurs, first note that the A and B alleles code for proteins that exist on the surface of red blood cells; in contrast, the third allele, O, codes for no protein."

Sorry if im wrong

5 0
3 years ago
If I breed a short for FF female with a short for Ff male then I will expect to see what type of offspring
Usimov [2.4K]
If being short is the dominant trait, then you should expect the offspring to also be short.

This is because the traits are spread out as four different possibilities. Either FF, FF, Ff, or Ff. If the dominant trait is being short, “F” then this would mask the recessive trait “f”.
5 0
3 years ago
Where did margaret mead live in the 1930s to conduct her study of cultural variation?
navik [9.2K]

Answer:

In the 1930's, she lived in New Guinea. It is an island north of Australia.

3 0
3 years ago
Read 2 more answers
What is the basis on which the subdivisions in a Geological time scale are made
Andru [333]
 <span>The geologic time scale is divided into periods, which are then divided into epochs, which are further divided into ages. For example, the time of the dinosaurs lasted 3 periods (Triassic, Jurassic, Cretaceous), each period had 3 epochs (late, early, middle), and each age fit into one of those. Many epochs have more than 1 age associated with them. 
As for the basis for differentiating the eras, I'm not so sure. The only one I can say for sure is the end of the Cretaceous, which is when the dinosaurs suddenly became extinct due to a meteor impact. I think the divisions are based on significant, global-scale events that changed the world.

Sorry its so long but that the answer i think >:) ur welcome

</span>
3 0
3 years ago
What are two ways drugs can increase the concentration of neurotransmitters in a<br>synapsee?​
lukranit [14]
Lighting the drugs together
7 0
3 years ago
Other questions:
  • A researcher investigates a blood disease carried by birds. She isolates an organism from the blood of an infected bird. She fin
    12·1 answer
  • CORRECT + BEST EXPLANATION GETS BRAINLIEST
    6·2 answers
  • I need help on my account please it is a biology question.
    7·1 answer
  • Kyle wanted to make some extra money over the summer. He decided that, to make the most money possible, he needed to gather scie
    11·2 answers
  • I NEED HELP! FIRST TO ANSWER GETS BRAINLIEST!! &lt;3
    9·1 answer
  • When electric current flows through the metal filament of a light bulbs, electrical energy is converted to
    5·1 answer
  • At the back of the brain is the __________ which is primarily responsible for processing information about light and movement
    12·2 answers
  • which of the following can be used to compare the amount of radioactively labeled DNA in two or more samples
    11·1 answer
  • Please help
    7·2 answers
  • Amoeba Sisters: Video Recap Pedigrees HELP
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!