1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bixtya [17]
3 years ago
10

A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes t

he following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include
Biology
1 answer:
wel3 years ago
8 0

Answer:  Identify the promoter and the stop signal (terminator).

Explanation:

DNA is a molecule that contains the genetic information in all living things. This information is used for the synthesis of proteins that make up the body and carry out vital functions of the organism.

The DNA molecule consists of two strands that wind around each other to form a double helix structure, where each strand has a central part formed by sugars (deoxyribose in the case of DNA) and phosphate groups. The four basic components of DNA are nucleotides: adenine (A), thymine (T), guanine (G) and cytosine (C). The nucleotides are joined together (A to T and G to C) by chemical bonds and form base pairs that connect the two strands of DNA. Depending on the sequence of nucleotides (which have different bases), different proteins are synthesized.

<u>DNA replication consists of synthesizing another identical DNA molecule, using enzymes called polymerases, which are molecules specifically dedicated only to copy DNA. Transcription, on the other hand, is the process by which a copy of messenger RNA (mRNA) is generated from the sequence of a gene in the DNA. </u>This RNA molecule leaves the cell nucleus and enters the cytoplasm, where it directs protein synthesis (a polymer made up of many amino acids).

<u>Protein synthesis, or translation, involves translating the sequence of an mRNA molecule into an amino acid sequence during protein synthesis.</u> The genetic code describes the relationship between the sequence of base pairs in a gene and the corresponding sequence of amino acids it encodes. To begin translation, a start codon (set of 3 bases) must first be identified, which is usually AUG that also codes for the amino acid methionine. Then, the codons that follow are read and the corresponding amino acids are added according to the genetic code. The transfer RNA (tRNA) is complementary to the anticodon at specific codons in the messenger RNA and carries the amino acid coding for the codon. In addition, ribosomal RNA (rRNA) is an RNA that is part of ribosomes and is essential for protein synthesis in all living things. rRNAs form the framework of ribosomes and associate with specific proteins to form ribosomal pre-subunits. To finish the translation, a termination codon has to be read, which can be UGA, UAG or UAA.

To revise the model to show transcription to form mRNA, the research should identify the promoter and the stop signal. The promoter is a DNA sequence required to turn a gene on or off. The transcription process starts at the promoter which is usually located near the beginning of a gene and has a binding site for the enzyme that is used to make a messenger RNA (mRNA) molecule. The enzyme RNA polymerase will keep doing the transcription until it reaches a sequence of DNA that is signal which indicates it should stop. This process is called termination, and it happens once the enzyme reaches this sequence, called terminator.

You might be interested in
Do you think the challenge society faces with regard to feeding the world's growing population is an example of ecological carry
Minchanka [31]

Answer: Yes

Explanation:

Carrying capacity can be defined as the total number of members of the population of a species that an ecosystem can sustain in terms of providing resources in the form of food, shelter and others. When the resources are available in surplus then the population of a species increases exponentially but declines when resources become scarce. The human population is increasing tremendously all over the world this is supported by the resources like food, water, fossil fuels, air, minerals, and others. But some of these resources are decreasing due to overuse and may not be available in future to sustain the future generation.

7 0
2 years ago
Why are estuaries such rich habitats for organisms
andreyandreev [35.5K]
Estuaries are areas where fresh water from rivers meets salt water. As the river drains, it carries much nutrient-rich sediment. Many animal species depend on this food source to provide for their young.
8 0
3 years ago
Ana is six weeks pregnant, and her baby is officially in the embryo stage. What does the baby now have?
Helga [31]
If I'm not mistaken, I believe the baby has a heart beat.
8 0
3 years ago
Read 2 more answers
What is a difference and similarity of genotype and phenotype?
NemiM [27]
A genotype is determined by your genes and a phenotype is by your physical features

6 0
3 years ago
How are evolution and allele frequency connected?
Lostsunrise [7]

Answer:

An example of macroevolution is the evolution of a new species. One mechanism that drives evolution is natural selection, which is a process that increases the frequency of advantageous alleles in a population. Natural selection results in organisms that are more likely to survive and reproduce.

7 0
3 years ago
Read 2 more answers
Other questions:
  • A major part of an ecosystem was washed away by a flood. Only two male deer and two female deer survived from the original popul
    13·1 answer
  • What do you think determines the gender of a human baby?
    6·1 answer
  • How hydrogen bond related to water polarity?
    7·1 answer
  • What problem does human population growth pose for transportation needs and socioeconomic issues, and what are some possible sol
    11·1 answer
  • CAN SOMEONE HELP ME ON 4
    5·2 answers
  • Name the two stages of photosynthesis and list the starting molecules and ending molecules of each.
    7·1 answer
  • Which type of cells are the least limited in differentiation?
    6·2 answers
  • Do human blood cells contain a cell wall?
    5·2 answers
  • Which of the following statements describes how population size and population density are related?
    11·1 answer
  • Why would scientists analyze another specimen from the same species
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!