1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aloiza [94]
2 years ago
7

___plants/factories use the force of water to generate electricity.

Biology
1 answer:
Art [367]2 years ago
3 0
The awnser will be e
You might be interested in
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
If you ate a jelly doughnut for breakfast, the largest component of the energy would come from the
PtichkaEL [24]
The doughnut because it contains carbohydrates
6 0
3 years ago
Read 2 more answers
Sleep could be best described as a __________. a. car with the engine started, but parked and idling b. truck driving on the fre
qaws [65]

Answer:

The best answer is A) A car with the engine started, but parked and idling.

Explanation:

This mean are body still breathing and pumping blood but were not aware and cant move.

-<u><em>Hope This Helps!</em></u>

<u><em>-Justin:)</em></u>

3 0
2 years ago
Will give brainliest bio help C and D
nikitadnepr [17]
Yes it will help you with c and d
6 0
3 years ago
What are the structures of a villi?
daser333 [38]
What the other person said!
3 0
3 years ago
Read 2 more answers
Other questions:
  • what creates more pressure check all that apply A.going to a lower altitude B.Gases with less kinetic energy C.Gas molecules mov
    11·1 answer
  • Intestinal virome changes precede autoimmunity in type i diabetes-susceptible children. 2017. proc natl acad sci u s
    7·1 answer
  • A student observed a dying plant in the corner of their science classroom. They learned the process of Photosynthesis and Cellul
    12·1 answer
  • Which of the answer choices does not occur when the antidiuretic hormone (ADH) is present?
    7·1 answer
  • Which of the following would have the greatest ecosystem diversity? Group of answer choices a lake a prairie the land an organic
    13·2 answers
  • Tại sao khi chi bị đau một bộ phận nào đó trong có thể những ta vấn thấy toàn có thể bị ảnh hưởng ?
    5·1 answer
  • Name the process by which sugar moves into cell A.
    11·1 answer
  • Which of the following molecule is NOT needed for the Calvin Cycle to take place?
    14·2 answers
  • The GO phase is for cells that do not
    13·1 answer
  • When you donate blood, it can be used for blood transfusions. Transfusions are common during certain surgeries or when a person
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!