1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lubasha [3.4K]
3 years ago
8

Suppose a person developed a mutation in a somatic cell which diminishes the performance of the body’s natural cell cycle contro

l proteins. This mutation resulted in cancer yet, but was effectively treated with a cocktail of cancer-fighting techniques. Is it possible for this person’s future children to inherit this cancer causing mutation? Be specific when you explain why or why not.
Biology
1 answer:
LenaWriter [7]3 years ago
3 0

Answer:

awdawd

Explanation:

You might be interested in
[Please help me with this question and please explain WHY you chose what you chose] The diagram shows a plant and an animal cell
Free_Kalibri [48]

Answer:

B. Both cells use the same molecules for energy

Explanation:

The mitochondrion is considered the powerhouse of the cell and it is the only place that makes energy in the cell

7 0
3 years ago
Which is the definition of an embryo?
stira [4]
Here is the definition
<span>

an unborn or unhatched offspring in the process of development.</span>

4 0
4 years ago
Read 2 more answers
Enzyme synthesis in a living cell occurs at which cytoplasmic organelles? A) vacuoles B) centrioles C) chromosomes D) ribosomes
joja [24]

Enzymes are proteins

protein synthesis ocurs in the ribosomes

7 0
3 years ago
Read 2 more answers
A population's density describes how A-old the population is b-crowded the population is c- big the population is d-fast the pop
WARRIOR [948]

Answer:

b im pretty sure

Explanation:

Population density is the average number of individuals in a population per unit of area or volume. For example, a population of 100 insects that live in an area of 100 square meters has a density of 1 insect per square meter.

6 0
3 years ago
mRNA is a complementary copy of a Dna strand. Write in the complementary RNA bases for the DNA template strand below.
Komok [63]

Answer:

UUC AUA GCU CCA ACU GGA UAG

Explanation:

4 0
3 years ago
Other questions:
  • What do you call the end of a straw wrapper that a waiter leaves on your straw when serving your drink?
    5·1 answer
  • Which of the following names something that is made of matter?
    9·2 answers
  • Predator-prey relationships DECREASE
    15·1 answer
  • Moist in some filters incoming air Prince food and liquid from entering vibrates and produces sound exchanges oxygen and carbon
    14·1 answer
  • What causes the gases to move in the lungs during gas exchange?​
    15·2 answers
  • Help plz i will do anything
    9·2 answers
  • How does the absence of vascular tissue in nonvascular plants affect their structure and appearance?
    9·1 answer
  • Roberto has twice the mass his sister Mary has but runs at the same velocity as Mary. Will his kinetic energy be twice as much?
    7·1 answer
  • How do non-native species affect the populations within the ecosystem where they are introduced?
    8·2 answers
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!