Every time an impulse travels down the axon, we say that the axon has "fired," or "responded." this impulse is also called the

The pros of having this rock plug is that the plug is protective and makes it so that Vesuvius is not likely to erupt again and the magma below has cooled and is harmless. The cons are that if there is another eruption, it will be deadly and create an avalanche of gas, rocks, and hot ash.

6 0

3 years ago

1. Studies conducted in England during the Industrial Revolution have shown that children born to poor families were, on average

yKpoI14uk [10]

1. The most likely explanation for this difference in height is a difference in nutrition because rich families have a better lifestyle than poor families.
2. The disease must be recessive because there is a window diagram of people who inherit the genetic disease.
3. A farmer chooses the cows in his or her herd that produce the most milk and breeds only those cows. The explanation in this is the group of cows that produce the most milk are probably the ones who have the link of family lineage between them. Breeding of healthy cows produces also healthy cows thus healthy cows will be breed to each other.
4. Increasing the amount of crop harvested should be the advantage of the farmer. Increase of the amount of crop harvested means increase of the farmer's income.
5. D. Blastocyst > zygote > embryo > fetus. Blastocysts are structures that formed early in day 5 of in-vitro fertilization process which will be transformed later into zygote. The zygote will undergo in a division process called mitosis and after the first eight weeks of fertilization, embryo will be formed. Bodily or organ structures will then appear and after this development by twelfth week of fertilization, fetus will be formed and this will be the last stage of development that includes growth.
6. The new cell that is formed from fertilization is called zygote. This eukaryotic cell is produced from joining of two gametes together.
7. Egg-laying land animals have evolved to produce eggs with tough shells to ensure that external fertilization can take place with caution and safety. Tough shells are needed to protect the cell that undergoes fertilization.
8. Plants and animals reproduce in different ways but they both carry hereditary material from parent. Genes from their origins are carried and the appearance of some trait will be shown by the offspring.
9. There is a 50% that the second offspring will be a girl. It really depends on the genetic material and biological character of the mother and there are factors that needs to be checked upon giving birth.
10. One of the plants has the nutrients and light it needs to grow and flower, while the other does not. The environment is similar between the two plants but the manner or means of taking care of it depends on the people who own it. This also affect the access of the pollinator to the flower if a flower does not have any nutrients to give.
11. Over time, a plant pollinated by a hummingbird has developed very long, tube-like flowers. The longer, tube-shaped flowers probably developed to keep the hummingbird from reaching and drinking the flower’s nectar. Birds are creatures who flies high and the for them to reach the flower's nectar, the plant should also be high.
12. Pollen inside the cherries fertilizes ovules, which produce seeds. This helps to reproduce the plant of cherry trees because seeds are the source and without seeds there would be no plants or trees to grow.
14. A plant that reproduces with flowers is called angiosperm with a scientific name of magnoliophyta, subkingdom of embryophyta.
15. At certain times of the year, the male sage grouse can be seen inflating the air sacs on his chest and singing loudly to a female sage grouse. This behavior is likely an example of a courtship ritual practiced or acted by the nature of male animals. The male animal are would try to impress the female animal by showing off their talent or giving them anything to offer for an intercourse.
16. In humans, the developing embryo receives nutrients and oxygen through a tube called the umbilical cord. This tube is connected between a mother and a fetus inside the mother's body. The nutrients received by the mother will also be received by the neonate by means of infusion or absorption through the barrier.

8 0

4 years ago

I need to perform RNA transcription and translation on this strand of DNA, given that the mRNA is the opposite of this DNA stran

Anarel [89]

Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.

In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.

So the mRNA strand would be the following :

AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.

So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region

Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.

4 0

3 years ago