Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer:
because they can donate blood to anyone
Explanation:
Answer:
Explanation:The Carnian Pluvial Episode (Late Triassic) was a time of global to a major extinction event and might have been the trigger of the spectacular known delta system by area (1,000,000 km2) in Earth history.
Answer:
Nitrogen is a naturally occurring element that is essential for growth and reproduction in both plants and animals. It is found in amino acids that make up proteins, in nucleic acids, that comprise the hereditary material and life's blueprint for all cells, and in many other organic and inorganic compounds.
Explanation:
(I just copy and paste from google)
They are sandwiched between two layers of heads. Recall that the heads are hydrophilic therefore they will always be on the outside and the tails are hydrophobi therefore they willl always be away from water, there fore sandwiched. I'm a bio major, hope I helped :)
