1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anna [14]
4 years ago
13

What is the only reasonable and ethical way to achieve zero population growth?

Biology
1 answer:
andriy [413]4 years ago
6 0
By limiting the number of live births to only what is needed to replace the existing population
You might be interested in
Explain how famine, disease, and war are more likely with larger populations.​
Iteru [2.4K]
Famine- High population means more mouths to feed
Disease- Diseases usually spread more quickly with people who live closer( as it can just move from one person to the other)
War- People like to fight for land, resources, money, etc. And having more of those things mean they are more able to support families, communities, and more.

(Hope this helps a little)
7 0
3 years ago
Read 2 more answers
What is the difference between raw data and results​
andreev551 [17]

Answer:

Explanation: raw data is the data that makes the results the results are what come from the data

8 0
3 years ago
how do birds identify members of the same species a. Methods of sharpening beaks b. Migration patterns c. Producing a distinct c
Oliga [24]
The answer is C. It's kind of like how humans speak in different languages. So do birds. They may make different noises but they are all still birds.
7 0
3 years ago
Which type of organism feeds on dead organisms whilst respiring to release carbon dioxide into the atmosphere
Serggg [28]

Answer:

decomposers

Explanation:

6 0
2 years ago
A molecule of DNA has been separated into two separate strands to be replicated. One of the strands is
denis23 [38]
T-C-C-(G-A-C-G-T-T)
8 0
2 years ago
Other questions:
  • Describe the journey of a human egg from where it begins in an ovary until the fertilized egg implants and begins to divide and
    14·1 answer
  • Why is it important to have a standard form of measurement in science?
    5·1 answer
  • Most plants are ___?
    10·2 answers
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • By which process are fossil fuels formed?
    9·2 answers
  • 2. I know that living things get their energy by
    9·2 answers
  • What is sensorineural?
    9·1 answer
  • Which region of your brainstem plays a role in arousing you to a state of alertness when, for example, you accidentally stumble
    15·1 answer
  • What anchoring junctions hold the cells of the stratum spinosum tightly together?
    13·1 answer
  • Calculate the increase<br> in the mouse population<br> between months 23 and 25.<br> Show your work.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!