1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
raketka [301]
3 years ago
11

Videohound's complete guide to cult flicks and trash pics

Biology
1 answer:
Feliz [49]3 years ago
4 0
Pardon? I don’t understand the question
You might be interested in
What two foods are stored as products of photosynthesis
antiseptic1488 [7]

Answer:

rice flour and rice

Explanation:

Plants changes the glucose into starch, for example mealies (mealies and maize flour), rice (rice flour and rice) and wheat (flour). Plants then store this food in different parts of the plant that an animal will eat. They can store it in their leaves, stems or roots, flowers, fruits or seeds.

5 0
2 years ago
Read 2 more answers
Name two Indian Cow breeds And one foriegn breed. 100 POINTS !!!
Gala2k [10]
HEYA!!!!


The answer to your question is

Two Indian Cow Breeds are ;

Hallikar
Hariana Cattle

Foreign Breeds:-
Brown Swiss

Hope it helps you.

:)


7 0
3 years ago
Read 2 more answers
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Farmer Tom only breeds the largest hogs, the fastest horses, and the cows 1 point
Marta_Voda [28]

Answer:

Artificial Selection

Explanation:

8 0
2 years ago
Read 2 more answers
What kind of organism can conduct cellular respiration
Artyom0805 [142]

both plants and animals can if that helps. So any living being I think...

4 0
3 years ago
Other questions:
  • The nurse is assisting the client in planning care during exacerbations of ménière's disease. which diet would the nurse identif
    12·1 answer
  • Name 15 different types of sharks and write one sentance that describe each!
    7·1 answer
  • What percentage range of an adult's kilocalories is recommended as the maximum to be obtained from fat?
    6·1 answer
  • Contrast the location of genetic material in bacterial cells to its location in plant and animal cells
    8·1 answer
  • Is a tiger shark a vertebrate or invertebrate
    12·1 answer
  • HELP ASAP
    14·1 answer
  • What is a cell and its structure?​
    9·2 answers
  • There is a medical expert on television discussing the latest advances in implantable cardioverter-defibrillators. What is this
    11·2 answers
  • Limiting nutrients often...
    6·2 answers
  • Someone help and answer. Cellular respiration and photosynthesis are related because
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!