1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maria [59]
3 years ago
5

Explain why the adrenal and thyroid glands atrophy if the pituitary gland ceases to function

Biology
2 answers:
natima [27]3 years ago
7 0
You will go crazy and start to get slower breaths
Brums [2.3K]3 years ago
6 0

Answer;

This is because the nervous system would no longer be linked to the endocrine system.


The reason as to why the adrenal and thyroid glands atrophy if the pituitary glands cease to function is because the nervous system would no longer be linked to the endocrine system.


Thyrotrophic and adrenocorticotrophic hormones from the anterior pituitary keep the adrenal and thyroid glands in action. If pituitary stops secreting them, it is obvious that adrenal and thyroid would be affected.

You might be interested in
What is mRNA?
Deffense [45]

Answer:

Messenger RNA is a type of RNA that is necessary for protein production. In cells, mRNA uses the information in genes to create a blueprint for making proteins. Once cells finish making a protein, they quickly break down the mRNA. mRNA from vaccines does not enter the nucleus and does not alter DNA.

So the answer will be C or A

Explanation:

7 0
2 years ago
Vì sao nói, tế bào là đơn vị cơ sở của sự sống?
PSYCHO15rus [73]

Answer:

Tế bào được coi là đơn vị cơ bản của sự sống một phần vì chúng có dạng gói rời rạc và dễ nhận biết. Đó là bởi vì tất cả các tế bào được bao quanh bởi một cấu trúc gọi là màng tế bào - giống như những bức tường của ngôi nhà, đóng vai trò như một ranh giới rõ ràng giữa môi trường bên trong và bên ngoài tế bào.

Explanation:

8 0
2 years ago
The Tasmanian devil has 14 chromosomes in each of its somatic cells, 2n = 14. How many chromosomes would be present in a cell af
nikitadnepr [17]
How many chromosomes would be present in a cell after anaphase of Mitosis?
During anaphase, sister chromatids separate to opposite sides of the cell. Therefore the 4n after doubling returns to 2n at each end of the dividing cell after anaphase. But until cytokinesis (1 cell pinching into 2), it's still one cell therefore 4n = 28
6 0
3 years ago
Read 2 more answers
Which molecule changes as a result of a genetic engineering procedure?
Alenkinab [10]
A)amino acid is the correct answer
7 0
3 years ago
A ___ can grow deep into ground to access water, and can also store food for the plant
disa [49]
Roots....................
3 0
3 years ago
Other questions:
  • The science of the classification of organisms is _____.
    12·1 answer
  • Often called the power plant of the cell, this is the site where most of the energy from carbohydrate, protein, and fat is captu
    11·2 answers
  • Which of the five fluorine-containing molecules have no dipole moment?
    7·1 answer
  • QUICK ANSWER PLZ
    5·1 answer
  • Mr. Smoke has had a persistent cough and hoarseness for several months. The doctor has scheduled Mr. Smoke for an examination of
    5·1 answer
  • Examples of asexual
    10·2 answers
  • How was osmosis involved in causing Clark’s seizures?
    10·2 answers
  • Heellllppp is the one i picked correct?
    9·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Look at page 4 of the document, question 3, gathering data. This is for a science gizmo. You just have to do the table and pls h
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!