1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oksanka [162]
3 years ago
9

Diffusion of oxygen from an alveolus into a pulmonary capillary belongs to which aspect of respiration?

Biology
1 answer:
Eva8 [605]3 years ago
3 0
Cellular respiration
You might be interested in
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
ntroduction: The 19th century was the time of the Industrial Revolution in England. Most of the new industries used coal for ene
Rasek [7]

Answer:

Light colored peppered moths decreases in number and dark colored peppered moths increases.

Explanation:

The population of light colored peppered moths decreases whereas the dark colored peppered moths increases in number because the light colored peppered moths are visible to the predator birds  whereas the dark colored peppered moths are not visible due to dark coating of the trees so they are saved from the birds and therefore, increase in population of dark colored peppered moths occurs and decrease occur in light colored peppered moths population.

5 0
2 years ago
What process does the bacteria Rhizobium undergo as a benefit to plants?
ratelena [41]
The answer is Nitrogen fixation

Hope it helps and don’t forget to click the thanks button please plz plz plz.
3 0
2 years ago
Why do dolphins kill more people every year than sharks?
Alik [6]

Answer:

Dolphins use their strong snouts as a powerful weapon to ram sharks, targeting their soft underbellies and gills to cause injuries. Sharks pose less of a threat to larger members of the dolphin family. Indeed, orcas are the top predator in the ocean and small sharks are a target for some populations.

8 0
2 years ago
Which of the following codes for a specific protein?<br> DNA<br> Gene<br> Enzyme<br> Chromosome
Sholpan [36]
The answer is DNA which cods for spesific protein
7 0
2 years ago
Other questions:
  • Hunters have greatly reduced the duck population visiting and living around this wetland. We would expect to see an increase in
    6·2 answers
  • Put the following terms in the order that oxygen passes through them to reach your blood: alveoli, lung, trachea, nose, bronchi.
    8·1 answer
  • How does heat flow inside Earth move the tectonic plates?
    15·1 answer
  • Classify each characteristic of transcription according to whether it is found in prokaryotes only, eukaryotes only, both, or ne
    15·1 answer
  • Which part of a plant absorbs water and anchors the plant in the soil?
    6·1 answer
  • Biology. Carbohydrates.
    13·1 answer
  • Glucose is a molecule that can move across the cell membrane. If the concentration of glucose is higher outside the cell then wh
    10·1 answer
  • Why do plants have rigid barks
    7·1 answer
  • What is extracellular matrix ? in simple words pls​
    12·1 answer
  • Match the term to the definition. Question 3 options: higher solute concentration low solute concentration 1. hypotonic 2. hyper
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!