1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Shkiper50 [21]
4 years ago
14

PLZ HELP WILL MARK BRAINLIEST

Biology
2 answers:
Lady_Fox [76]4 years ago
8 0

The correct answer is Cnidarians.

nlexa [21]4 years ago
5 0

The answer is that it is a C- cnidarian.

You might be interested in
How do meteorologists indicate different types of weather fronts on a weather map?
Mandarinka [93]

Answer:

A stationary front is depicted by an alternating red and blue line with a triangle on the blue portion and half-moon on the opposite side of the red portion of the line. A cold front (or warm front) that stops moving becomes a stationary front.

Explanation:

5 0
3 years ago
In what way is DNA replicated?
RideAnS [48]

Explanation:

C. Semi-Conservative

i believe this is the answer

8 0
3 years ago
Be aware of mudflows. the danger from a mudflow increases near stream channels and with prolonged heavy rains. mudflows can move
Anettt [7]

The mudflows are very dangerous and they have a great destructive power. They appear after a heavy rainfall on places that are steep. The mudflows are very fast and sudden occurrences, so usually people are caught unprepared. A mudflow is a mixture of water and lot of ground/mud, and all sorts of debris, which also contributes to it to be more dangerous.

8 0
3 years ago
Read 2 more answers
A scientist observes changes in a population of slow-moving animals over time. She hypothesizes that the population may be decre
EastWind [94]
Blank 1- scientific
blank 2- extinct
6 0
3 years ago
Read 2 more answers
Crossing-over can occur during meiosis I in:
m_a_m_a [10]

Answer:

b. metaphase l.

3 0
3 years ago
Read 2 more answers
Other questions:
  • What protects earths surface
    11·1 answer
  • Are there more than one air mass if so.PLZ help
    6·2 answers
  • How might a person use a floating stick to measure the speed at which a river flows?
    5·1 answer
  • What did charles darwin learn from the fossils of a giant armadillo that he found in argentina?
    14·1 answer
  • What skin infection is caused by fungi and results in a reddish circle appearing on the skin?
    7·1 answer
  • Explain in detail about Phospholipid Bilayer.
    12·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • What percent of the DNA produced during replication is new?
    6·2 answers
  • How does chlorophyll aid in the process of photosynthesis? *
    10·1 answer
  • Please answer thiis lol?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!