1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
KiRa [710]
3 years ago
11

A student wonders if adding fertilizer to the soil will make tulips grow faster. The student’s hypothesis states, “If fertilizer

is added to the soil, then the tulips will grow faster, because fertilizer adds nutrients to the soil.” Which of the following variables is the independent variable?
Biology
2 answers:
yawa3891 [41]3 years ago
6 0
The fertilizer is the independent variable.

Serhud [2]3 years ago
4 0

Answer: Fertilizer

Explanation:

Independent variable can be defined as the factor which can be controlled by the person performing the experiment.

The experimenter can control whether he will put fertilizer in soil or not. The growth of tulips will depend on the fertilizer as it is a source of nutrient to the plant.

here, the hypothesis will be either accepted or rejected based on the result of experiment.

You might be interested in
How do cells make up living organisms?
Lorico [155]

Answer:

multiple types of cells that are connected make up all living organisms

Explanation:

since biology explains the definition of cells, being the structural unit of all living organisms, it qualifies the statement that multiple types of cells connect to make up living organisms.

7 0
3 years ago
Define the term excretion.
Arisa [49]

The liver breaks down many substances in the blood, including toxins. The liver also excretes bilirubin — a waste product of hemoglobin catabolism — in bile. ... The lungs are responsible for the excretion of gaseous wastes, primarily carbon dioxide from cellular respiration in cells throughout the body.

4 0
2 years ago
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
What makes the cell theory a scientific theory?
hoa [83]
It has to be confirmed through scientific tests in a lab.
3 0
2 years ago
Because the interior of the lipid bilayer contains the nonpolar _______________, only small nonpolar substances are able to diff
Ivan

Because the interior of the lipid bilayer contains the nonpolar _____molecules__________, only small nonpolar substances are able to diffuse directly across the cell membrane

6 0
3 years ago
Other questions:
  • Uno larguito, dos más bajitos, otro chico (small) y flaco (skinny), y otro gordazo (fat). ¿qué son?
    10·1 answer
  • Which of the following has a positive effect by acting as an artificial reef in some areas?
    9·1 answer
  • Suppose that the coding region of a gene contains 1,800 base pairs, with 570 in exon 1, 420 in exon 2, and 810 in exon 3 (not co
    13·1 answer
  • SOMEONE THAT CAN PLEASE HELP ME ON THESE MORE THAN ONE CAN BE CHOSEN
    14·1 answer
  • "A total artificial heart (TAH) is an electrically powered pump that circulates blood into the pulmonary artery and the aorta, t
    15·1 answer
  • Why would freezing a balloon full of air causer to shrivel
    7·2 answers
  • Ano una ko’ng tatapusin?<br><br> A. Modules<br> B. Gawaing bahay<br> C. Buhay ko<br> D. Activities
    14·2 answers
  • HELPPPPPPPPPPPPPPPPPPPP
    7·2 answers
  • In your own words, describe how a model can be useful in science.
    6·1 answer
  • A cell with a diploid number of twelve chromosomes undergoes meiosis. What will be the product at the end of meiosis?.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!