1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vikentia [17]
3 years ago
6

What are seamounts?

Biology
1 answer:
soldi70 [24.7K]3 years ago
5 0
<span>c) volcanoes that form on the oceans floor</span>
You might be interested in
This is the general condition of a body or organism.
leonid [27]

Hello! Your answer would be health.

Your health could be completely fine but also could have a condition or illness that prevents the body or mind from working normally.

Hope this helped :))

6 0
3 years ago
Read 2 more answers
The atmosphere is considered _____ because of its ability to transport and distribute materials throughout the globe quickly.
natta225 [31]
It is a I guess but I m not sure
5 0
3 years ago
Read 2 more answers
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Auroras are lights that appear at Earth’s northern and southern poles. What is the main cause of an aurora?
deff fn [24]
When charged particles from the sun strike atoms in earth's atmosphere, it causes electrons to move to a higher energy state. When the electrons drop back to a low energy state they release light photons. This is what causes the Aurora lights
6 0
3 years ago
Describe at least 2 ways in which nature can impact an ecosystem over a long period of time.
Juliette [100K]

Answer:

Can destroy habitats and food supply

Explanation:

8 0
3 years ago
Other questions:
  • Which term describes erosion? C- transport solid materials A.creates small particles B.hardens rock fragments C.transport solid
    10·2 answers
  • In which type of climate does chemical weathering usually occur most rapidly?
    14·2 answers
  • Are Moon craters the result of volcanoes or impacts?
    11·1 answer
  • What composes the backbone, or side pieces, of the DNA molecule?
    14·1 answer
  • PLEASE HELP 50 POINTS PLSSSSSS
    15·2 answers
  • Why do you want to read research by scientists who use the scientific method? Select all that apply.
    6·1 answer
  • Structural Difference between the heart and the lung
    8·1 answer
  • Which of the following provides evidence for past tectonic plate motions? *
    10·1 answer
  • What are the parts of an bacteria
    10·1 answer
  • The fatty membrane that hangs like an apron from the inferolateral margin of the stomach and overlies the small intestine is cal
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!