1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Monica [59]
3 years ago
13

In life cycles that alternate between haploid and diploid stages, ____________ acts to reduce the number of chromosomes per cell

from two sets to one set. In life cycles that alternate between haploid and diploid stages, ____________ acts to double the number of chromosome per cell from one set to two sets. In life cycles that alternate between haploid and diploid stages, ____________ acts to keep the number of chromosomes per cell the same. In animals, a single diploid cell called a ____________ divides by mitosis to give rise to all the cells of the adult body.
Biology
1 answer:
777dan777 [17]3 years ago
3 0

Answer:

meiosis_

fertilization

mitosis

zygote

Explanation:

In life cycles that alternate between haploid and diploid stages, ____meiosis_ acts to reduce the number of chromosomes per cell from two sets to one set. In life cycles that alternate between haploid and diploid stages, ___fertilization__ acts to double the number of chromosome per cell from one set to two sets. In life cycles that alternate between haploid and diploid stages, ______mitosis______ acts to keep the number of chromosomes per cell the same. In animals, a single diploid cell called a ____zygote________ divides by mitosis to give rise to all the cells of the adult body.

You might be interested in
When a cell copies its DNA (replication), the original DNA ladder is broken apart and new nucleotides are added to the center. T
VladimirAG [237]

1. TTGCATGCTAGCTACGTGTACGTACCGATGCG

2. GGGCCCATACGTACATGCATGCAGCATATAGC

3. GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

You should double check those to make sure I didn't make any mistakes. Hope this helps!

5 0
3 years ago
Many researchers argue that teens today have weaker social skills than teens of the past because they are no longer used to comm
baherus [9]

Answer:

Teens have more social interactions per day through electronic devices

Explanation:

While it may be true that teens have more social interactions per day through electronic devices,

6 0
3 years ago
Read 2 more answers
When the more dense crust dives into the asthenosphere, it continues to pull the rest of the crust with it. This is called _____
Helen [10]

slab pull

Explanation:

When the more dense crust dives into the asthenosphere, it continues to pull the rest of the crust with it. This is called slab pull.

The pulling effect of a subducting plate on the rest of the plate is known as slab pull.

  • In describing plate tectonics and movement of different plates, the term slab pull is frequently used.
  • It is used to illustrate the dragging of a plate mass on all its part.
  • A slab is a lithospheric plate.
  • At a subduction margin, colder plates will sink because they are more denser.
  • The whole mass of the plate moves down regardless of how rigid and brittle they are.

Learn more:

Lithosphere brainly.com/question/9582362

#learnwithBrainly

6 0
3 years ago
What are two scientific ideas that have changed throughout and why they have changed?
enyata [817]
One is that the earth is shaped as a circle and two is that it is shaped as a square
8 0
3 years ago
Explain the water cycle in your own words.
Lynna [10]

Answer:

the water cycle how water evaporates from the surface of the earth, rises into the atmosphere, cools and condenses into rain or snow in clouds, and falls again to the surface as precipitation.

the series of processes by which carbon compounds are interconverted in the environment, involving the incorporation of carbon dioxide into living tissue by photosynthesis and its return to the atmosphere through respiration, the decay of dead organisms, and the burning of fossil fuels.

The nitrogen cycle is the biogeochemical cycle by which nitrogen is converted into multiple chemical forms as it circulates among atmosphere, terrestrial, and marine ecosystems. The conversion of nitrogen can be carried out through both biological and physical processes.

3 0
3 years ago
Other questions:
  • Ethical concerns about the development and use of biotechnology include all of the following except________.
    13·2 answers
  • How is the activity of a riboswitch controlled? metabolite binding can change its structure?
    7·1 answer
  • The fundamental explanation for the cause of cancer is that (2 points)
    5·2 answers
  • What modification of cellular respiration might you expect to find in dormant seeds?
    14·1 answer
  • How does volcanic ash form
    5·2 answers
  • DO all organisms share the same genetic code
    12·1 answer
  • An abnormality in an individual's DNA is called a (n)
    11·2 answers
  • This is sugar found in the side chains of DNA.​
    9·1 answer
  • Elizabeth is a schoolteacher. She is drawing a marine food chain on the board. Which marine organisms should be at the base of t
    15·1 answer
  • What process involves making RNA based on the sequence of nucleotides 12
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!