1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
TEA [102]
4 years ago
13

If photosynthesis produces cellular energy (atp) from sunlight, why do plant cells also need to perform cellular respiration, a

process that produces atp from sugar
Biology
1 answer:
Reika [66]4 years ago
8 0
If a plant just did photosynthesis then the plant would not have any food and just an abundant amount of ATP. they use cellular respiration to make food they can use to grow
You might be interested in
Part B: Find Credible Sources
sashaice [31]

A sample citation of sources using the MLA citation methods is Author(s).<em> "Title of Article." Title of Periodical, Day Month Year, pages.</em>

<h3>What is a Research Paper?</h3>

This refers to the expanded essay that is written in order to find answers to research questions in an academic writing format.

Hence, we can already see that a list of reliable sources has been mentioned already and the important questions to ask when using sources for a research paper.

Therefore, we can see that when using Modern Language Association (MLA) citation methods, one should place the name of the author(s) in alphabetical order, then the title of the article, day, month, and year, then the pagination.

Read more about credible sources here:

brainly.com/question/784877

#SPJ1

7 0
2 years ago
What is the answer please help no links I will report
GrogVix [38]

Answer:

Limpets

Explanation:

Since the arrows represent flow of energy, and there is no path of energy from fish to limpets, limpets won't be affected at all.

7 0
3 years ago
Help please? I don't understand
slavikrds [6]
I believe its A because a bonds with t g bonds with c and c bonds with g, translated to rna it's UCG.
3 0
3 years ago
Use Figure 1 to evaluate each trigonometric function of angle A . The side adjacent to angle A has length 8 and the side opposit
jonny [76]

The trigonometric ratios are;

  • Sin A = 0.78
  • Cos A = 0.625
  • Tan A =  1.25
<h3>What are the trigonometric ratio?</h3>

The trigonometric ratios are sine, cosine and tangent. Now we have the hypotenuse of the triangle. Figure 1 has been shown in the image attached to this answer.

c = √8^2 + 10^2

c = 12.8

sin A = 10/12.8 = 0.78

Cos A = 8/12.8 = 0.625

Tan A = 10/8  = 1.25

Learn more about the trigonometric ratios:brainly.com/question/13724581

#SPJ1

7 0
2 years ago
What empirical evidence could most effectively and directly be used to convince law makers to remove a dam that is blocking a ri
9966 [12]
<span>B.) Information on the distance from the ocean to the rivers that the salmon use. >? i think this would be it since they would not even be able to reach the area needed to breed >?</span>
8 0
3 years ago
Read 2 more answers
Other questions:
  • Zachary is a 17-year-old male who appears boastful, conceited, and arrogant. When someone accuses him of being that way, he flie
    11·2 answers
  • When glaciers melt, water is returned to groundwater storage by what means?
    10·2 answers
  • Having malformed hands with shortened fingers is a dominant trait controlled by a single gene; people who are homozygous for the
    14·1 answer
  • Explain the relationship between three aspects of science: hypothesis, research/experimentation, and theory.
    5·2 answers
  • How does the spinal cord work with other systems to keep the body healthy? Give at least 3 examples
    12·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • During what stage of photosynthesis is o2 produced
    10·1 answer
  • A cell whose cytoplasm has a concentration of 0.02 molar glucose is placed in a test tube of water containing 0.02 molar glucose
    14·1 answer
  • The action by which a plant grows toward sunlight is called _____.
    6·2 answers
  • Pls help asAP PLS❗❗❗❗❗❗❗❗❗❗❗❗❗❗
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!