1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sholpan [36]
3 years ago
10

S calling an object dumb personification

Biology
1 answer:
Luba_88 [7]3 years ago
8 0
Dumb isn’t necessarily a human characteristic. i suppose it will depend on the context.
You might be interested in
How many million years ago did the supercontinent Pangaea form
igor_vitrenko [27]

Answer:

335 million years ago

Explanation:

Pangaea or Pangea ( /pænˈdʒiːə/) was a supercontinent that existed during the late Paleozoic and early Mesozoic eras. It assembled from earlier continental units approximately 335 million years ago, and began to break apart about 175 million years ago.

8 0
3 years ago
Of the following, where would we most likely find water in the form of a gas?
Sophie [7]
1 the atmosphere because gas is everywhere. 
7 0
3 years ago
Read 2 more answers
What first spurred research into what has now become green building?
Ghella [55]
San Francisco has an opportunity to reap tremendous economic, environmental, and health benefits by adopting recent advances in “green building”—benefits that will only increase in value over time. Many standard building design, construction, operation, and renovation practices are outmoded, inefficient, costly, and have adverse health and economic effects. The shift to new, environmentally sensitive practices would maintain San Francisco’s status as a leader in urban planning and environmental innovation. A shift to green buildings is also vital to enhancing San Francisco’s livability for its residents, workers, and visitors.

8 0
3 years ago
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
How do ships float in water​
Liula [17]

The air that is inside a ship is much less dense than water. That's what keeps it floating! ... As a ship is set in water, it pushes down and displaces an amount of water equal to its weight

6 0
3 years ago
Other questions:
  • All of the following are stages in the human menstrual cycle except
    6·2 answers
  • What kind of atom tens to lose one electron
    12·1 answer
  • ¿Que diferencias hay entre plaguicidas y fertilizantes?
    13·1 answer
  • Will give brainliest:
    7·1 answer
  • 20 POINTS - MONOHYBRID CROSS
    14·2 answers
  • If a scientist needs to use a large dataset to explore how corn grows in different soils, how would this data be classified? A.
    14·2 answers
  • The allele for red hair is recessive to the allele for black hair. What colour hair will a person have if he inherits an allele
    15·1 answer
  • Plz help.................
    7·2 answers
  • Zoom I'd : 4111799601 pswd : 123​
    11·2 answers
  • Tissue working together makes an-<br> A. Organism<br><br> B. Organ
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!