1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Maslowich
2 years ago
11

Wich event will follow dna replication in a cell cycle

Biology
1 answer:
jekas [21]2 years ago
5 0
DNA replication occurs in the S phase. After that is G2, which is growth and final preparations for division. Chromosomes are checked for errors and repairs are made if needed. Essentially, the cell prepares for division.
You might be interested in
The ____ system is like a chemistry lab which breaks down complex proteins and starches into simple chemicals
Elena-2011 [213]
The answer would be C. Digestive
The <em />circulatory system <em>circulates</em> the blood and lymph throughout the body. The excretory system <em>excretes</em> the body wastes.
7 0
3 years ago
What would happen to the concentrations of
svetoff [14.1K]

Answer:

Pyruvate - stay the same

NADH - increase

H+ - decrease

Explanation:

4 0
2 years ago
Read 2 more answers
Removal by suction of fluid or gas from a body cavity is ______________.
Kisachek [45]
The answer would be "<span>aspiration".</span>
4 0
3 years ago
Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3
marysya [2.9K]
It should be
AGATACCATGGTTACCCGGTTCCA
6 0
2 years ago
When is the carbon stored in plants released?
nikdorinn [45]

Answer:

A

Explanation:

hope this helps:))))))))))))

4 0
3 years ago
Read 2 more answers
Other questions:
  • Write a list of three interesting scientific questions. Is each one testable?
    7·1 answer
  • Which process skill requires the use of the senses?
    12·1 answer
  • A black-eyed cat mates with an orange-eyed cat and produce all offspring with black eyes. Assuming these genes follow mendelian
    15·1 answer
  • What relationships exists between an enzyme &amp; a catalysts?
    8·1 answer
  • According to Nutton, we are unable to identify any diseases familiar to us today because because we are hampered by the great di
    15·1 answer
  • Antibiotics, antimicrobial resistance and the control of disease - Essay
    11·1 answer
  • If a molecule is to large or polar and cannot easily diffuse into the cell, it is
    15·1 answer
  • If something is burned a reaction has occurred <br><br>​
    6·2 answers
  • AG CLASS NEED HELP ASAP
    12·2 answers
  • How do the nutrients in soil cause problems when erosion relocates the soil to ponds or lakes?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!