1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
VladimirAG [237]
3 years ago
6

How much food should you eat in a day to survive

Biology
2 answers:
Charra [1.4K]3 years ago
8 0

Answer:

if you're looking for a minimum, people only need to eat every three day to survive, but the recommended amount of calories is 3000 calories a day for an average adult.

Explanation:

anastassius [24]3 years ago
8 0

Answer:

2,2000-2,800 calories a day

You might be interested in
What have you learned about radioactive dating? Check all that apply.
Ksivusya [100]

A, B, and D


I hope this helps!

3 0
3 years ago
Which organ system is involved in protecting the body from both infectious and noninfectious diseases
grigory [225]
A. Immune system
It helps our bodies fight everything that comes in our path.
8 0
3 years ago
Read 2 more answers
The picture below shows a type of fish that is adapted to live in the weedy areas of freshwater lakes. image Which best describe
marissa [1.9K]
I think the answer would be A because the fish does look like a plant
4 0
3 years ago
Describe a way in which genetic engineering has helped criminal justice? I'm kinda confused by this. xD
Luden [163]
At a glance this one's confusing, I agree.
Genetic engineering has made it easier for forensic scientists to differentiate human DNA beyond simple blood sampling. This inevitable led to release of innocent accused prisoners.
5 0
3 years ago
Read 2 more answers
A Punnett square is used to determine the __________.
oee [108]
A. Probable outcome
7 0
3 years ago
Read 2 more answers
Other questions:
  • Read the following statements that describe how information flows in the nervous system. What is the correct order in which they
    9·2 answers
  • Why is gene expression important to the overall health of an organism?
    14·1 answer
  • Which nutrient is changed by bacteria into different forms? A.water B.oxygen C.nitrogen D.carbon
    7·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Which help scientists learn about the temperature and composition of stars
    14·1 answer
  • Which of the following is consumed by producers?
    8·1 answer
  • Traits will sort themselves into gamete independently of what other traits are doing.” This is Mendel’s law of __________.
    5·2 answers
  • Describe biological control.
    8·1 answer
  • Question 13 of 25
    13·2 answers
  • HELP. Are gills located internally or externally in the body of animal? DO NOT COPY FROM GÔO.GLE. I'VE ALREADY SEEN THAT AND I D
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!