1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Darya [45]
3 years ago
14

What is a characteristic of unsaturated fats

Biology
1 answer:
Harlamova29_29 [7]3 years ago
6 0
<span>Unsaturated fats have a very high boiling points. Another characteristic is that unsaturated fats become solid at room temperature.</span>
You might be interested in
What is the difference between molecules and compounds?
Nataly [62]
A molecule is when two or more atoms join together chemically. A compound is a molecule that contains at least two different elements. 
6 0
3 years ago
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
Humans carry a variety of non-functional genetic sequences, called processed pseudogenes, in their DNA. We can estimate how long
IrinaVladis [17]

Answer:

The correct answer is - c. CALM II psi3 (36 million years old)

Explanation:

7 0
3 years ago
The process of what adds a phosphate group to adp creating atp?
lara31 [8.8K]

Answer:

The conversion of ADP to ATP can be written as ADP + Pi + energy → ATP or, in English, adenosine diphosphate plus inorganic phosphate plus energy gives adenosine triphosphate.

7 0
3 years ago
If the ventral root of a spinal nerve were cut, what would be the result in the tissue or region that nerve supplies?
DerKrebs [107]

This would result in whatever effectors that spinal nerve controlled would no longer work; it would be paralyzed

7 0
2 years ago
Other questions:
  • In the 17th century many people in scientist believe spontaneous generation of life occurred what is spontaneous generation and
    13·1 answer
  • the below shows the distribution of marks obtained by a group of students in a mathematics test............... The marks are : 5
    15·1 answer
  • The remains of dead plants and animals get buried under soil to coal and oil over long periods of time. Which spheres are involv
    10·2 answers
  • All BUT one description applies to the structure of RNA. That is
    7·2 answers
  • Solomon is studying for class. To remember the term _____, he uses the analogy of a thermostat in a house. For instance, when th
    14·1 answer
  • How are models related to theories and hypothesis ?
    7·1 answer
  • what elements are in the most common substance in the human body? a. carbon and nitrogen b. hydrogen and oxygen c. oxygen and ph
    15·1 answer
  • Using the Gizmo, find a carbon atom path from the atmosphere to the cement plant. (Hint:
    6·2 answers
  • Which lists the correct order of evolutionarily history
    14·1 answer
  • What is the most significant difference in current weather forecasting methods compared to what was done in the past?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!