1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
3241004551 [841]
3 years ago
11

Can someone tell how to do this?

Biology
1 answer:
dolphi86 [110]3 years ago
7 0

Answer:

What specific question do you want answered so I can answer your question

Explanation:

There are multiple questions I have, what question do you want answered I need to know to assist you.

You might be interested in
MARKING BRAINLIEST !!!
photoshop1234 [79]

Answer: D. A river separates members of a squirrel population that used to occupy the same geographical area.

Explanation:

Allopathic Speciation occurs when a geographic barrier (river, mountain, or canyon) separates members of a population

Hope this helps!

3 0
3 years ago
you are an employer and know from genetic testing that the most qualified applicant for the job has a 70 % chance of developing
Ludmilka [50]
I would hire this person because the disease is non-communicable. Plus, small cold and cough problems will not affect the performance of the person and therefore, there are little chances that he/she will take frequent holidays. Further, morally this job will help the person financially, in getting the proper treatment of the disease, if it occurs. And this will also raise the confidence and personality of the person. If the person has the skills that match our requirements, I will definitely hire him, despite his chances of developing multiple sclerosis. 
7 0
4 years ago
Based on the similarities and differences you identified earlier between T. Brucei, P. Falciparum, and T. Cruzi, do you predict
OverLord2011 [107]

Answer:

Yes,  P. Falciparum and T. Cruzi undergo similar antigenic variation because of repetitive genomes evolved by time.

Explanation:

Living (i.e., actively proliferating) repeats are dynamic elements which reshape their host genomes by generating rearrangements, creating and destroying genes, shuffling existing genes, and modulating patterns of expression. Dead repeats (i.e., those which are no longer able to proliferate) constitute a palaeontological record, which can be mined for clues about evolutionary events and impetus. The dynamic nature of repeats leads to a rapid evolutionary divergence that can be used in species identification and phylogenetic inference. Repeats can also provide passive markers for studying processes of mutation and selection.

The genomes of these protozoan parasites, like all eukaryotic genomes, have been colonized by diverse repetitive elements. Repetitive sequences can be artificially divided into two groups: interspersed repeats and tandemly repeated DNA. P. falciparum undergoes antigenic variation ans similar anitgenic variation is present in t. cruzi because of repetitive sequences resembling each other.

7 0
3 years ago
What is the difference between a prokaryotic and a eukaryotic cells?
Ratling [72]

You are a eukaryote. Your cells are eukaryotic. Eukaryotic cells contain membrane-bound organelles, including a nucleus. Eukaryotes can be single-celled or multi-celled, such as you, me, plants, fungi, and insects.

Bacteria are an example of prokaryotes. Prokaryotic cells do not contain a nucleus or any other membrane-bound organelle. Prokaryotes include two groups: bacteria and another group called archaea.

7 0
3 years ago
Read 2 more answers
Jorge went for a run after his morning classes. He hadn't eaten breakfast and now he is feeling lightheaded and has a gnawing fe
Artist 52 [7]

The fact that Jorge hadn't eaten breakfast and now he is feeling lightheaded and has a gnawing feeling in his stomach means that he is experiencing hunger.

<h3>What is hunger?</h3>

Hunger occurs when an individual stays for a given period of time without food. We know that food are organic materials that contains the materials which are able to nourish the body. The food is broken down in order to produce the energy that is capable of nourishing the body and providing energy.

The fact that Jorge hadn't eaten breakfast and now he is feeling lightheaded and has a gnawing feeling in his stomach means that he is experiencing hunger.

Learn more about hunger:brainly.com/question/2929541

#SPJ1

7 0
2 years ago
Other questions:
  • An unnatural warming of the atmosphere near earth's surface is called
    7·1 answer
  • What are two ecosystem services provided for humans by forests?
    6·1 answer
  • - what are two reasons why the height of clouds vary from day to day?
    5·2 answers
  • Which of the following observations about flagella is accurate and is consistent with the scientific conclusion that the flagell
    7·1 answer
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • How might vital capacity be important to a musician?
    12·1 answer
  • Unlike Animals ,Fungi...
    15·1 answer
  • What can be combined to form various substances
    13·1 answer
  • What is our votingrights?​
    7·1 answer
  • Why does a solid change to liquid when heat is added?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!