1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
finlep [7]
3 years ago
15

.

Mathematics
1 answer:
vredina [299]3 years ago
7 0
No, the sequence is algebraic.
You might be interested in
Find the exact solution using common logarithms 2^5x+3= 3^2x+1
AfilCa [17]
2^{5x + 3} = 3^{2x + 1}
log_{2}(2^{5x + 3}) = log_{2}(3^{2x + 1})
(5x + 3)log_{2}(2) = (2x + 1)log_{2}(3)
5x + 3 = 1.58(2x + 1)
5x + 3 = 3.16x + 1.58
1.84x + 3 = 1.58
1.84x = -1.42
x \approx -0.77
6 0
4 years ago
While visiting Wallawulla State​ Park, Joe approximated the angle of elevation to the top of a mound to be 40 degrees . After wa
katen-ka-za [31]

Answer:

Height of mound = 794 ft

Step-by-step explanation:

To illustrate the angle of elevation and distance, i have drawn it and attached below.

Now, from my diagram;

h = the height of the mound

At his first point of his trip to the foot of the mound, the angle of elevation is 40°, while the horizontal distance to the foot of the mound is "X"

So, by triangle definition,

tan(40°) = h/x

And so;

h = x tan40

h = 0.8391x  - - - - (eq 1)

At his second point of the trip to the foot of the mound, Joe is now,

"(x - 450) ft" from the foot of the mound.

Thus, his angle of elevation is 40 + 18 = 58°.

So, by triangle definition,

tan(58°) = h/(x - 450)

h = (x - 450)•(tan(58°))

h = 1.6003(x - 450)

h = 1.6003x - 720.135   - - - - -(eq2)

To get the height(h) of the mound, let's equate (eq1) to (eq2).

0.8391x = 1.6003x - 720.135

1.6003x - 0.8391x = 720.135

0.7612x = 720.135

x = 720.135/0.7612

x = 946.0523 ft

Let's put this value for x in eq (1);

h = 0.8391 x 946.0523 = 793.83 ft ≈ 794ft

4 0
3 years ago
A company has 10 men qualified to run a machine that requires 3 operators at a time. find how many groups of 3 operators are pos
anzhelika [568]

The number of possible groups or combination of three men can be formed from 10 is 120.

According to the given question.

Total number of men in a company, n = 10.

Number of men to be selected, r = 3

As we know that, What is a combination in math?

Image result for what is combination

A combination is a mathematical technique that determines the number of possible arrangements in a collection of items where the order of the selection does not matter.

Therefore, the number of possible groups or combination of three men can be formed from 10

= ^{10} C_{3}

= 10!/ 3!7!

= 10(9)(8)/3(2)

= 5 × 3 × 8

= 120

The number of possible groups or combination of three men can be formed from 10 is 120.

Find out more information about number of possible groups or combination here:

brainly.com/question/3854382

#SPJ4

6 0
1 year ago
Please someone help me with this please
Elodia [21]
Help u with what I need to know what u need help on
3 0
3 years ago
Plzz help asap.......​
SSSSS [86.1K]

Answer:

29.78 feet

Step-by-step explanation:

4 0
3 years ago
Other questions:
  • It says check the solution to the example problem by replacing n in the original equation with -2 and evaluating both sides. Wha
    7·1 answer
  • Aaron needs a total of $410 to buy a new bicycle. He has $35 saved. He earns $15 each week delivering newspapers. How many weeks
    12·1 answer
  • Katie is k years old. Harry is 4 years older than Katie. Rachel is twice as old as Harry. If you add together the ages of Katie,
    6·1 answer
  • 0.16 as a fraction in simplest form
    12·1 answer
  • Please show ALL work!<br><br> Solve for x: log₂x+log₂(x-6)=4
    10·1 answer
  • Solve the equation -8=-3-63x2
    15·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Giving brainliest !!!
    14·1 answer
  • To which sets of numbers dose-1/4 belong. select each correct answer.
    13·2 answers
  • What is 12+x <br>(come and chill and talk)
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!