Answer:
The Battle of Midway was a decisive naval battle in the Pacific Theater of World War II that took place between 4 and 7 June 1942, in Midway Atoll only six months after Japan's attack on Pearl Harbor and one month after the Battle of the Coral Sea. Hope that helps!
 
        
                    
             
        
        
        
The two most obvious ones are on the far right, and near the far left. Oceanic lithosphere is descending into the earth's mantle at these places, and being destroyed. ... At convergent boundaries oceanic lithosphere is always destroyed by descending into a subduction zone
 
        
                    
             
        
        
        
Answer:
Because each mountain has its own way of being formed so its expected that each mountain would differ from the other 
 
        
             
        
        
        
Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5' 
 - Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
 - Translation: AUA UUA CUU CAA GGC UCC UAU
 
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
 - Guanine (G) connects and is complemented by cytosine (C) and vice versa.
 
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU