1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rudik [331]
3 years ago
10

The porosity and permeability of a soil are influenced by the ____ of the soil.​

Geography
1 answer:
Nat2105 [25]3 years ago
8 0
Structure I hope is the right answer
You might be interested in
Please someone pls help mee
denpristay [2]

Answer:

perceptual region ^^

Explanation:

4 0
3 years ago
Where did the battle of midway take place
julsineya [31]

Answer:

The Battle of Midway was a decisive naval battle in the Pacific Theater of World War II that took place between 4 and 7 June 1942, in Midway Atoll only six months after Japan's attack on Pearl Harbor and one month after the Battle of the Coral Sea. Hope that helps!

3 0
3 years ago
Read 2 more answers
Oceanic lithosphere is destroyed at?
alexdok [17]

The two most obvious ones are on the far right, and near the far left. Oceanic lithosphere is descending into the earth's mantle at these places, and being destroyed. ... At convergent boundaries oceanic lithosphere is always destroyed by descending into a subduction zone

3 0
3 years ago
Read 2 more answers
Why are the mountain ranges of the US different heights?
Alex73 [517]

Answer:

Because each mountain has its own way of being formed so its expected that each mountain would differ from the other

8 0
3 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Other questions:
  • What country in Asia is located at 20N/ 80E?
    6·1 answer
  • Explain how religion can be a centripetal force... please
    5·2 answers
  • Why is there a vast amount of salt water on Earth?
    12·2 answers
  • LA now the nations second largest city started as a ____ in the 1800's
    12·1 answer
  • What is antipodal balance between land and water?
    15·2 answers
  • (1) Plate tectonics envisions the Earth divided into dozens of lithospheric plates that move about and interact with one another
    11·1 answer
  • To induce someone to convert to one's own religious faith is to
    5·2 answers
  • Ans wer plsss plss plas​
    14·1 answer
  • What are general characteristics of tropical cyclone of tropical cyclone ?
    13·1 answer
  • Lord howe island is a volcanic island in the tasman sea that is about 11 km long and 2. 8 km wide
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!