1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ikadub [295]
3 years ago
11

Glycine is a highly conserved amino acid residue in proteins (i.e., it is found in the same position in the primary structure of

related proteins). Which of the following reasons is the most likely explanation for this observation
Biology
1 answer:
s2008m [1.1K]3 years ago
6 0

Answer:

Glycine contains a lone hydrogen atom in its side group which makes it less bulky than other amino acids

Explanation:

Glycine contains a lone hydrogen atom in its side group which makes it less bulky than other amino acids. This characteristic enables it to overcome strict effects or nonbinding barriers which be faced by other amino acids

You might be interested in
Find the measure of 3.
Verizon [17]
I think 131 but I’m not to sure...
8 0
2 years ago
what specific differences about the finches on the Galapagos Islands were of great interest to Darwin
anygoal [31]
The beak <span>structure is the difference</span>
9 0
2 years ago
Read 2 more answers
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
2 years ago
Which of the following statements is true?
Kamila [148]

Answer:

the answer is B = all living things are made of the same elements

5 0
1 year ago
What type of RNA comes together with proteins to form ribosomes and then becomes the site of translation?
aleksandrvk [35]

Ribosomal RNA (rRNA) associates with a set of proteins to form ribosomes. These complex structures, which physically move along an mRNA molecule, catalyze the assembly of amino acids into protein chains.


7 0
3 years ago
Other questions:
  • How might research on the flow of matter and energy through ecosystems be helpful to creating a colony on mars?
    14·1 answer
  • How do fats, oils, and waxes react with water inside the body?
    9·1 answer
  • What could be achieved by DNA profiling using gel electrophoresis?
    12·1 answer
  • Define virus, virion and viroid and explain the differences.
    11·1 answer
  • What theory promotes the idea that "only the strongest living organisms that can adapt to its surroundings" survive?
    14·1 answer
  • F a gene is inserted or deleted in a genome, these events can lead to new alleles forming that may cause variation within a spec
    14·1 answer
  • Corals use harpoon-like to catch food
    6·1 answer
  • Select ALL that apply-All living things *
    8·1 answer
  • 2) Which is NOT an example of an abiotic factor?
    12·2 answers
  • All cells regardless of type build themselves, build tissues, and transport, and make products.
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!