1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maks197457 [2]
3 years ago
8

Even though the Punnett square calculates that a couple has a 50/50 chance of producing a male or female, there are slightly mor

e females born in the human population. Why might this be?
Biology
1 answer:
lora16 [44]3 years ago
6 0
An egg is fertile when it ovulates. That's three days so male sperm gets to the egg quicker but it dies quicker too. So if couples have sex before ovulation by the time the egg is fertile the male sperm is dead which leaves the female sperm. This is why there may be more women than men.
You might be interested in
Pls help ill give anything
VARVARA [1.3K]

Answer:

Biotic, Abiotic

Explanation:

Question 4) <u>biotic</u> means living things and those all marked are living animals or plants

Question 5) <u>abiotic</u> these refer to non living things

4 0
2 years ago
Please help don’t have a lot of time
damaskus [11]

The answer would be 8, because in mitosis it creates and identical cell

5 0
3 years ago
What is one example of how it takes energy for motion to occur?
BlackZzzverrR [31]

Answer:

Lets say you are running in P.E. If you run for to long you get tired. When you are tired you run out of energy and cant run anymore.

Explanation:

7 0
2 years ago
Read 2 more answers
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
2 years ago
HELP FAST! PHYSICAL SCIENCE salt is added to a flask of water. the flask is sealed and shaken for several minutes.After being sh
densk [106]

Answer:the following can be done to allow more NaCl to dissolve;

1.) heating the mixture.

2.) Addition of extra water to the solution.

Explanation:

When sodium chloride is dissolved in water, the polar water molecules are able to work their way in between the individual ions in the lattice. The water molecules surround the negative chloride ions and positive sodium ions and pull them away into the solution. This process is called dissociation. Now when the solution is heated, the rate of the dissociation between the two molecules increases leading to more dissolution of NaCl. Also in the absence of heating, more Water molecules can be added to the solution to decrease it's saturation thereby favouring the dissolution of more NaCl.

6 0
3 years ago
Other questions:
  • Review the schematic diagram of photosynthesis and the involvement of the chloroplast in this process. All BUT ONE choice descri
    14·1 answer
  • If you wanted to study the diversity of organisms at all levels of biological organization what Would You Study
    11·2 answers
  • If carbon dioxide is removed from a plant’s environment, what would you expect to happen to its production of glucose
    11·2 answers
  • How are cancer cells generated?
    8·2 answers
  • Can you give me a long list of stinging insects
    5·1 answer
  • In maize, yellow kernel color is dominant to white, and wrinkled kernel shape is dominant to the smooth form. Considering both o
    8·1 answer
  • Investigators interested in studying the activation of apoptosis inject cytochrome c into the cytosol of two types of mammalian
    8·1 answer
  • Help pls, I'll give brainliest!
    9·1 answer
  • true or false? local biogeochemical cycles are isolated within their particular ecosystem and all ions and molecules remain in t
    14·1 answer
  • What is the difference between moons and dwarf planets?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!