1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frutty [35]
3 years ago
9

Which sentence describes one difference between DNA and RNA?

Biology
1 answer:
morpeh [17]3 years ago
7 0

DNA is double stranded describes the difference  between DNA and RNA.

<u>Explanation:</u>

Deoxyribonucleic acid refers to DNA stands for and ribonucleic acid refers to RNA. Information related to genes is carried by both RNA and DNA. Although they are similar in this way there are many differences that exists between them.

Sugar deoxyribose is contained in DNA whereas the sugar ribose is the content of RNA. Double-stranded molecule is DNA whereas  while single-stranded molecule is RNA.  In alkaline conditions DNA is stable but RNA is not stable. B-form double helix is the structural feature of DNA. A-form helix structural feature of RNA.

You might be interested in
The scuba diver is a living system. The scuba gear or self- contained underwater breathing apparatus, is a system of air exchang
Verdich [7]

Answer: The carbon dioxide is the output and oxygen is the input of the Scuba apparatus.

Explanation:

The scuba apparatus is a life saving apparatus used by the sea divers. It recycles the exhaled gas and removes the carbon dioxide and compensates for the utilized oxygen gas before the diver is actually supplied with the gas for the purpose of breathing in a circuit. Hence, the carbon dioxide gas is the output and the oxygen is the input.

5 0
3 years ago
Question 5 of 10
8090 [49]

the answer is A because A always goes with T

8 0
2 years ago
I need help please help me
Nuetrik [128]
The answer you are looking for is- Leopard seals are CARNIVORES. Hope I’ve helped.
6 0
3 years ago
Predict how many genetically different offspring could be produced by outcrossing two 2n=4 individuals (just account for indepen
Llana [10]

Answer:

16 genetically different offspring

Explanation:

This is the case as each parent has the ability to produce 4 uniquely different gametes through independent assortment. With such a scenario where each parent can product 4 uniquely different gametes multiplied by 4 parents, you have 16 offspring. So there's the possibility of producing 16 offspring that are unique.

4 0
3 years ago
Many neurons have many short, branching extensions called dendrites. what is the benefit of these structures for a neuron
wariber [46]
The answer is the dendrites offer a big apparent area for links from other neurons. The dendrites are the main open or input areas and offer an enormous surface area for receiving signals from other neurons. They have spines appendages in which come to close interaction with synapses with other neurons.

4 0
3 years ago
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • Which of the following is a true difference between t cells and b cells?
    11·1 answer
  • Air pollution is best defined as ________.
    8·1 answer
  • Which sentence describes energy flow through a natural (not manufactured) system?
    15·2 answers
  • The bacterium that causes tuberculosis can be expelled from the lungs by a cough and remain viable in the air for an hour or mor
    15·1 answer
  • How does hemodialysis work?
    12·1 answer
  • Look at the diagram How many peaks are on this shield volcano?
    15·1 answer
  • All organisms have a blank Habitat in which they live.
    11·1 answer
  • What is the technique of filling the viewfinder? How does this help to focus on your subject?
    10·1 answer
  • Generalized loss of brain tissue that results from direct alcohol toxicity is associated with alcoholic blank______, which is a
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!