1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
timama [110]
3 years ago
5

41. The sodium–potassium pump is an example of a system that uses primary active transport to set up conditions that will allow

secondary active transport, in this case, of glucose. All of the following about the sodium–potassium pump are true except: a. The Na+ –K + pump is an antiporter fueled by the hydrolysis of ATP. b. The subsequent movement of glucose into the cell is against its concentration gradient. c. The pump exports Na+ ions to the outside of the cell and establishes a concentration gradient for Na+ . d. K+ and Na+ both diffuse into the cell along their concentration gradients and drive the transport of glucose. e. The movement of glucose is coupled to the movement of Na+ by a symporter protein.
Biology
1 answer:
gogolik [260]3 years ago
6 0

Answer:

d. K+ and Na+ both diffuse into the cell along their concentration gradients and drive the transport of glucose.

Explanation:

Na/K pump is a pump located on the plasma membrane which uses ATP to move 3 Na ions out the cell and brings in 2 K ions into the cell. It is an example of primary active transport. As a consequence,concentration of Na is higher outside the cell, while K concentration is higher inside the cell.

Glucose is transported in the cell against its gradient, together with Na ions (symport) which move down their concentration gradient.

This is an example of secondary active transport because it uses the energy from the primary active transport to move other substances such as glucose against their own gradients.

You might be interested in
Assume that a single layer of phospholipids coat the water in a beaker. which part of the phospholipid molecule will face the ai
jek_recluse [69]
The part of the phospholipid molecule that will face the water, as it is labelled to be hydrophilic would be the polar phosphate group. The correct response would be A.
5 0
3 years ago
Read 2 more answers
Question 4 .Which process is a physical change?
ohaa [14]

Explanation:

Which process is a physical change?

c. melting ice

If you break a piece of glass, the shape of the glass changes, but the properties in the fragments remain the same. Which of the following has occurred?

d. a physical change

A substance made up of two or more elements that have been chemically combined is called

c. a compound

Of the three ordinary states of matter, gas is the only state that

c. is highly compressible

In which state of matter do the particles have the most energy?

b. gas

Elements in group 18 called Noble Gases are highly reactive because they have 1 valence electron.

false

Atomic mass is the sum of

b. protons and neutrons

The current model of the atom is known as

a. Rutherford's model

Most elements on the periodic table are

d. metals

Which is not a quality of a non-metal?

a. shiny

Hope this helps.

3 0
3 years ago
Cetaceans are whales and their relatives. The diagram shows some fossils of cetaceans.
alexgriva [62]

Answer:

i think it's "C"

Explanation:

because if both have similar structure then just have some relation

6 0
3 years ago
5) A white flower is crossed with a homozygous red flower (red is dominant).
kondaur [170]

Answer:

The Punnett square will look like this:

Rw Rw

Rw Rw

Explanation:

In order to have a white flower, both alleles must be recessive. A homozygous red flower must have two dominate alleles.

Well use (w) for white, and (R) for red.

The parent alleles are:

1 - ww

2 - RR

(see picture)

6 0
3 years ago
Describe how restriction enzymes and ligase enzymes are used to make the plasmids that are introduced to bacteria cells during t
balandron [24]

Answer:

DNA restriction enzymes cut the DNA molecule, while DNA ligases join the resulting DNA fragments

Explanation:

Transformation is a naturally occurring process by which bacteria incorporate exogenous genetic material from their surrounding environment. This process (transformation) is used for DNA cloning via plasmid vectors. In DNA cloning, transformation occurs after restriction enzymes cut the DNA at specific sequences named palindromic sequences (i.e, sequences that can be read the same in opposite direction). Restriction enzymes can generate sticky-ends, where enzymes make staggered cuts in the two strands (e.g., <em>BamH</em>), or blunt ends, where the resulting strands are of the same length (e.g., <em>HaeIII</em>). In general, sticky-end enzymes are more useful because they generate a 3' overhang in one molecule and a complementary 5' overhang in the other, increasing the yield and specificity of ligation. During ligation, a DNA ligase is used to join both DNA strands by forming phosphodiester bonds in the plasmid. Following transformation, bacteria can be selected on antibiotic plates.

8 0
3 years ago
Other questions:
  • during a science fair a group of students came up with the following colon is color an inherent property in objects or is it a p
    7·2 answers
  • What makes these tumor suppressor proteins so important?
    9·1 answer
  • Arrange the steps in which farmers can use the electricity produce by micro hydropower systems
    8·1 answer
  • Malonate is a competitive inhibitor of succinate dehydrogenase. If malonate is added to a mitochondrial preparation that is oxid
    11·1 answer
  • Explain why cuboidal cells would not work as well as squamous cells in the alveoli of the lungs
    6·2 answers
  • Why viruses are unable to reproduce on their own
    11·2 answers
  • Helppp, i need this asap
    11·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • What is a gene? Choose the definition that best matches the term Gene.
    13·2 answers
  • How can you distinguish between an energy transfer and energy transformation
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!