1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
raketka [301]
3 years ago
5

How does the large central vacuole in plants help maintain homeostasis?

Biology
1 answer:
Delicious77 [7]3 years ago
7 0
Maintaining acidity- <span>In case the pH in the environment drops a lot (becomes very acidic), there is a flux of H ions from the cell's cytoplasm into the cell's vacuole thereby increasing acidity to required level and thus maintaining the </span><span>specific pH </span><span>in the cells internal environment as well.

Turgidity- </span><span>Vacuoles regulate the turgidity by regulating the amount of water inside the cell. </span>
cell has excessive water:<span> vacuole absorbs the water and then diffuses it out of the cell.</span>
cell lacks water<span>: water from the vacuole gets passed back into the cell thereby maintaining turgidity. 

And here's a video </span>https://youtu.be/3tqjITi8S8s

You might be interested in
Which nutrient type would most affect the skeletal system
avanturin [10]
Calcium

Vitamin D

Vitamin K

Phosphorus

vitamin C
5 0
4 years ago
Read 2 more answers
Which method do you think best represents energy flow through ecosystems? Why?
marissa [1.9K]
Pyramids of biomass display the weight of organisms at each level. Inverted pyramids of biomass can occur when the primary producer has a high turnover rate. Pyramids of energy are usually upright and are the best representation of energy flow and ecosystem structure.

I’m sorry if this didn’t help I’m still new to answering questions on Brainly
4 0
3 years ago
HELP PLEASE I NEED THE ANSWER ASAPPPP
Hoochie [10]

Answer:

I think that it's A.

Explanation:

It's not D, because A & C contrast each other.

5 0
3 years ago
Read 2 more answers
Which event marks the beginning of the cambrian era?
Scilla [17]

Answer:

D) largest mass extinction event in Earth's history

Explanation:

The cambrian era started following the pre-cambrian extinction

5 0
3 years ago
15) Cara and Chuck were looking at pond water through a microscope. They saw this image. Cara wondered what it was. Chuck said i
masha68 [24]
15)C
16)D because the function of mitochondria is providing energy
17)B cell wall
18)C cell membrane
19)C plantae
20)B cytoplasm
6 0
3 years ago
Read 2 more answers
Other questions:
  • The inability of alveoli to function is called
    6·1 answer
  • How does technology affect the advancement of science
    6·1 answer
  • Which is used to create copies of genetic material for DNA fingerprinting?
    13·1 answer
  • A congenital growth composed of a mass of superficial, dilated blood vessels is known as a/an ________.
    15·2 answers
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • The shoulder blades are more ___ than the chest
    5·2 answers
  • It is always important to note possible sources of error in the conclusion.
    12·2 answers
  • (If you copy and paste your answers from go.ogle you will not receive credit)
    13·1 answer
  • In the experiment determining the parental genotype of plant seedlings from a monohybrid cross, if the dominant color was green
    14·1 answer
  • If y'all hvae course hero and can see this, please help
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!