1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
RSB [31]
4 years ago
5

What are the two types of dip-slip faults and how are they different from each other?

Biology
1 answer:
ozzi4 years ago
4 0

Answer:

Dip-slip faults are inclined fractures where the blocks have mostly shifted vertically. If the rock mass above an inclined fault moves down, the fault is termed normal, whereas if the rock above the fault moves up, the fault is termed reverse. A thrust fault is a reverse fault with a dip of 45 degrees or less.

Hope this helps if not sorry

You might be interested in
List 5 observations Darwin made about the Amblyrhynchus lizards.
Lady bird [3.3K]

They are poikilothermic or cold-blood

been seen eating the feces of crabs and sea lions

only ocean dwelling iguanas in the world

orient themselves so that they absorb sun through the skin

salt glands connected to the nostrils allows them to expel access sea salt

3 0
3 years ago
Select all of the answers that apply. The Sun emits a lot of radiation. The different types of radiation are the electromagnetic
beks73 [17]
<span>radio waves, microwaves, gamma rays, X-rays, visible rays

Hope this helps</span>
3 0
3 years ago
Read 2 more answers
Part B
cluponka [151]

Answer:

The word acidification can be misleading because a pH of 7.9 is still considered slightly alkaline. However, as the graphs in these three locations show, as CO2 rises, the pH drops, moving in the direction of the acidic end of the pH scale.

Explanation:

4 0
3 years ago
Read 2 more answers
Select the correct answer. The graphic shows two isomers of a chemical compound with molecular formula C5H11NO2. Which type of i
Ierofanga [76]

a. Structural Isomers

hope u have a good day!

3 0
3 years ago
Select the correct answer from each drop-down menu.
Natalija [7]

Answer:

The first blank is "<u>Food Service workers</u>" The Second blank is "<u>Housekeeping Staff</u>".

Explanation:

House keepers sanitize the room and surfaces for the next guest, and food service workers have guidelines they must follow to insure every customers safety.

5 0
3 years ago
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • What creates the Van Allen belts? A. Earth's aurora borealis B. Earth's gravity C. Earth's magnetosphere D. Earth's mantle conve
    14·2 answers
  • A mitosis inhibitor is a medication that is designed to prevent mitosis in certain cells. why would these be helpful in the trea
    6·1 answer
  • 100 points hurry will mark as brainliest⁉️⁉️⁉️⁉️
    7·2 answers
  • Which phase of mitosis is the cell most likely in when a cell is found to have two nuclear envelopes and spindles that appear to
    5·1 answer
  • How does overtillage harm soil?
    10·2 answers
  • An organism is classified as a heterotroph or autotroph based on the type of ________ it utilizes.. A. respiration source (e.g.,
    11·1 answer
  • A red blood cell and plant root hair cell both have​
    10·1 answer
  • A neuron that stimulates the gastrocnemius muscle receives signals from multiple areas of the brain. This is an example of
    6·1 answer
  • True/False and Fill-in-the-blank 1. The mass of atoms, their size, and how they are arranged determine the __________ of a subst
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!