1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tpy6a [65]
3 years ago
14

All the known dwarf planets except Ceres orbit in the A. asteroid belt. B. Milky Way. C. Kuiper belt. D. Oort cloud.

Biology
1 answer:
Snezhnost [94]3 years ago
5 0

Answer:

It is located in the asteroid belt between Mars and Jupiter

You might be interested in
9. Write an mRNA strand that is complementary to the DNA strand AATTGC. Circle a codon.
andrew-mc [135]

Answer:

UUAACG

Explanation:

The complementary strand of the DNA strand AATTGC would be UUAACG.

The complementary nucleotide for Guanine [G] will be Cytosine [C] and applies to both DNA and RNA. But the complementary nucleotide for Adenine [A] will be Thymine [T] in DNA and Uracil [U] in RNA.

A codon is a triplet of nucleotides, so it could be any three nucleotides in the strand. Example: AAT, ATT, TTG or TGC.

3 0
3 years ago
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Asteroids may be called planetoids (minor planets) because the largest known asteroid is only about kilometers in diameter.
Alla [95]

Answer: 1,000

Explanation:

The largest asteroid known as Ceres is about 950 - 1000 kilometers in diameter.

7 0
3 years ago
Read 2 more answers
Birth control pills contain a combination of estrogen and progesterone that signal the pituitary gland to not release follicle-s
zloy xaker [14]

Answer:

True.  

Birth control pills contain a combination of hormones that prevent the formation of the ovule, by prevent the formation of the luteinizing follicle.  There are several types of birth control pills,but the process is generally the same

Explanation:

6 0
3 years ago
Explain why a sound wave cannot travel in a vacuum?
Leto [7]
Sound cannot travel through a vacuum. A vacuum is an area without any air, like space. So sound cannot travel through space because there is no matter for the vibrations to work in.
3 0
3 years ago
Read 2 more answers
Other questions:
  • Wolff's law of bone explains the effect of __________.
    15·1 answer
  • The difference in concentration from one side of a membrane to the other is what forms the __________ driving force
    7·1 answer
  • After population growth, what does the United Nations believe will be the greatest future global pattern?
    12·2 answers
  • Question 2 Which of the following is true of metamorphism? Metamorphism changes only the shape of rocks. Metamorphism changes on
    13·1 answer
  • Which of the following would describe Lamarck’s ideas about evolution?
    14·2 answers
  • At the end of this phase, two new daughter cells that are exact replicas of the beginning cell will be completed.
    6·1 answer
  • The earth's continents move at certain times of the year due to the motions of the tectonic plates. True or false
    14·2 answers
  • What is responsible for the apparent motion of the Moon in the sky from East to West? A) The rotation of Earth about its axis B)
    5·1 answer
  • A liver cell must create a protein to carry fats through the body. Where would the instructions be found?
    6·2 answers
  • These three questions hard asab​
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!