1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ilya [14]
3 years ago
5

Please answer this.. please

Biology
1 answer:
ki77a [65]3 years ago
4 0

Answer:

10.8 amu

Explanation:

11 * 0.80 = 8.8 (11 represents ion, 0.80 represents %)

10 * 0.20 = 2 (10 represents ion, 0.20 represents %)

8.8 + 2 = 10.8 amu

You might be interested in
Does anyone know how to do this
Annette [7]

Answer:

but i think it's C

Explanation:

4 0
3 years ago
Two students are comparing scientific experiments to investigations. They came up with the following ideas.
eimsori [14]

Answer:

A. Student A because it requires a hypothesis

7 0
3 years ago
Read 2 more answers
Spawning is when a
Mumz [18]
The answer is (b.) male and female fish release their gametes together.
5 0
3 years ago
In the modern classification system birds are in a separate _______ from reptiles, but fossil evidence shows they have _________
aliina [53]

B) class; a common ancestor
6 0
4 years ago
Read 2 more answers
What is the most specific taxonomic grouping in which all three cats are the same
Leokris [45]
According to the hierarchy it is the Genus
6 0
3 years ago
Read 2 more answers
Other questions:
  • Help it’s science if u don’t mind! Thx!
    11·1 answer
  • Selective cutting is preferable to clear-cutting because it _____.
    8·2 answers
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • What is the name of the processes that change the genetic information into each new form?
    8·1 answer
  • The hydrophilic regions of a membrane protein are most likely to be found are
    13·1 answer
  • Complete all questions in blue font
    5·1 answer
  • 3. Earthquakes are the vibrating and ___
    13·2 answers
  • Mantle convection is a process of ___ that creates circular currents in the asthenosphere. As a result, the __ plates slowly mov
    10·2 answers
  • Is reproduction anabolic or catabolic​
    7·2 answers
  • Why do most living thing not leave fossils behind
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!