Answer:
TACTTCGAGAAAACCAACGAAAAGTGGTAA
Explanation:
Transcription is the process by which a strand of DNA is copied into mRNA.
Remember that in mRNA, U (Uracil) bonds with A (Adenine).
Hope that helps.
Answer:
Scientists figured out that the outer core must be liquid because S waves do not pass through it, but P waves do. The behavior of P and S waves also indicates that the inner core is solid. The speed of seismic waves also depends on the density of the material through which they are traveling.
Explanation:
Hello. This question is incomplete. The full question is:
"Drag the terms on the left to the appropriate blanks on the right to complete the sentence. Terms may be used more than once.
1- free water
2- Solute
During osmosis, water diffuses across a selectively permeable membrane from the region of higher _______ concentration and lower _____ concentration to the side with lower _______ concentration and higher _______ concentration
.
Answer:
During osmosis, water diffuses across a selectively permeable membrane from the region of higher free water concentration and lower solute concentration to the side with lower free water concentration and higher solute concentration
Explanation:
Osmosis is a biological process that takes place in cells and allows a substance to pass through the plasma membrane. Through osmosis, the plasma membrane, water can pass into and out of the cell through a gradient of solute concentration, that is, water passes from the place with the lowest concentration of solute to the place with the highest concentration, allowing thus the balance between the inter and extra cellular medium.
C. Halogens
Think of HOFBrINCl
Bromine, Chlorine, Fluorine, and Iodine are all in the acronym and they are all hydrogens
