1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sasho [114]
3 years ago
12

What are the reactants in photosynthesis?

Biology
2 answers:
Lerok [7]3 years ago
4 0

Answer:

light energy, water, carbon dioxide and chlorophyll

kakasveta [241]3 years ago
3 0
Carbon dioxide + water + energy from light produces glucose and oxygen.
You might be interested in
Help I'm confused!
aev [14]

Answer:

TACTTCGAGAAAACCAACGAAAAGTGGTAA

Explanation:

Transcription is the process by which a strand of DNA is copied into mRNA.

Remember that in mRNA, U (Uracil) bonds with A (Adenine).

Hope that helps.

7 0
3 years ago
Scientists have discovered that the inner core of Earth is a solid while the outer core is a liquid. What is the cause of this o
Arte-miy333 [17]

Answer:

Scientists figured out that the outer core must be liquid because S waves do not pass through it, but P waves do. The behavior of P and S waves also indicates that the inner core is solid. The speed of seismic waves also depends on the density of the material through which they are traveling.

Explanation:

5 0
3 years ago
Please please please help! Very important!
lions [1.4K]
The answer is allele
7 0
4 years ago
Drag the terms on the left to the appropriate blanks on the right to complete the sentence. Terms may be used more than once.
Dima020 [189]

Hello. This question is incomplete. The full question is:

"Drag the terms on the left to the appropriate blanks on the right to complete the sentence. Terms may be used more than once.

1- free water

2- Solute

During osmosis, water diffuses across a selectively permeable membrane from the region of higher _______ concentration and lower _____ concentration to the side with lower _______ concentration and higher _______ concentration .

Answer:

During osmosis, water diffuses across a selectively permeable membrane from the region of higher free water concentration and lower solute concentration to the side with lower free water concentration and higher solute concentration

Explanation:

Osmosis is a biological process that takes place in cells and allows a substance to pass through the plasma membrane. Through osmosis, the plasma membrane, water can pass into and out of the cell through a gradient of solute concentration, that is, water passes from the place with the lowest concentration of solute to the place with the highest concentration, allowing thus the balance between the inter and extra cellular medium.

3 0
4 years ago
A chemical family whose members exist as reactive diatomic molecules in the gaseous phase is the?
Musya8 [376]
C. Halogens
Think of HOFBrINCl
Bromine, Chlorine, Fluorine, and Iodine are all in the acronym and they are all hydrogens
7 0
4 years ago
Other questions:
  • Determine the volume of the figure shown below and round the answer to include the correct number of significant figures
    14·1 answer
  • Like animals, plants must maintain an internal balance, or _____.
    7·1 answer
  • Which statement best defines a cell?
    5·1 answer
  • The air pressure has been rising for the last several days. What is likely true about the weather?
    14·1 answer
  • which was one of the main benefits to use of the icebox for cooling food select all that apply provided a source for cold water
    8·1 answer
  • There are many different types of scientific investigations, including controlled experiments, observational field studies, the
    14·2 answers
  • How are the prices of goods and services determined in a market economy?
    7·1 answer
  • HELP WILL GIVE BRAINLIEST IF CORRECT: What effect do plants' roots
    12·2 answers
  • Help me please plssssssssssssss
    6·1 answer
  • Gabriel's grandmother suggested he gargle salt water to help soothe his sore throat. he added salt to a bottle of water from his
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!