1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vera_Pavlovna [14]
3 years ago
7

The karyotype indicates a problem with chromosome 18. What is the problem and what is the BEST explanation for why it occurred?

Biology
2 answers:
Solnce55 [7]3 years ago
7 0
A karyotype views the nucleus of the cell and the inspects the number and the appearance of the chromosomes. This would mean that the nature of the problem could be
<span>A) extra chromosome; insertion 
AND
</span>D) mutated chromosome; crossing over<span />
stepladder [879]3 years ago
5 0

C is the correct answer


You might be interested in
4. Scientists have most accurately determined the absolute ages of rock layers by
Vladimir [108]

Answer:

B

Explanation:

7 0
3 years ago
What is the function of a cell membrane?
lina2011 [118]

Answer:

The plasma membrane, or the cell membrane, provides protection for a cell. It also provides a fixed environment inside the cell, and that membrane has several different functions. One is to transport nutrients into the cell and also to transport toxic substances out of the cell.

Explanation:

6 0
3 years ago
Read 2 more answers
The polen grains in this plant causes asthama in man​
iragen [17]

Answer:

I hope this helps :)

Explanation:

Tree pollen is a common hay fever trigger. It’s the first pollen to be released during hay fever season, and levels are typically highest from late March to mid-May.

Around 95% of people’s hay fever is triggered by grass pollen, which tends to be highest between mid-May and July. In fact, there’s strong evidence that when grass pollen levels are high, people with asthma are more likely to need hospital treatment.

Hay fever can also be triggered by weed pollen, which is highest from the end of June until September.

Know your pollen triggers

You can be allergic to more than one kind of pollen across the year. Different pollens are released at different times, but our changeable weather makes it hard to predict exactly when. If you have hay fever symptoms all year round you might have non-allergic rhinitis.  

If you regularly get hay fever and take antihistamines, start taking them up to four weeks before you normally get symptoms. Starting them early means that when pollen starts being released, the medication has already built up in your bloodstream so you may be less likely to react.

If you usually use a steroid nasal spray, it can take up to two weeks to start working, so again, start using it before your personal pollen trigger is released.

7 0
3 years ago
Evidence that supports the prokaryotic origins of mitochondria and chloroplasts are all of the following except __________.
hodyreva [135]

Your question was incomplete (please check below the full content). The evidence that supports the prokaryotic origins of mitochondria and chloroplasts do not include multiple DNA copies associated with inner membranes.

<h3>What is organellar DNA?</h3>

The organellar DNA is the genome contained within mitochondria and chloroplasts, which is independent of nuclear eukaryotic DNA.

The organellar DNA contains multiple DNA molecules, which are found in association with the inner membrane, ant is not found in prokaryotic life forms.

The complete question in this case is: "Evidence that supports the prokaryotic origins of mitochondria and chloroplasts are the presence of mitochondria, a eukaryote engulfing prokaryotic photosynthetic cells, and non-photosynthetic eukaryotes, EXCEPT."

The endosymbiotic theory states that mitochondria and chloroplasts evolved from prokaryotic microorganisms that entered into a primitive eukaryotic cell.

This theory is supported by certain features of mitochondria and chloroplasts such as a similar size to prokaryotes.

In conclusion, evidence do not include the arrangement of the organellar DNA.

Learn more about mitochondrial DNA here:

brainly.com/question/1563697

#SPJ1

8 0
1 year ago
When you place a ball at the top of a hill and it accelerates toward the bottom
Alenkinab [10]

Answer:

When a ball accelerates toward bottom it experiences both rolling friction and air resistance.

Explanation:

  • When the ball rolls from the hill the gravitational force of attraction comes in action and accelerates the ball toward the bottom of the hill.
  • This motion of ball is the rotational motion,  rolling friction acts on it due to rotational motion.
  • As the velocity of the ball increases air resistance also starts to have significant effect on its motion.
  • These two forces try to oppose the motion of the ball.
8 0
4 years ago
Other questions:
  • The __________ nervous system transmits messages about sight, sound, smell, taste, and tactile information.
    15·1 answer
  • The ability of a process to be repeated in the same manner by another individual is called
    7·2 answers
  • What's reproduction n respiratory system
    7·1 answer
  • If the low power objective lens has 10x printed on the lens, what would be the total magnification?
    9·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • If global warming continues, global average temperature could rise by 4ºC by the end of the century. Which of the following effe
    13·1 answer
  • What is an allele in bio?
    13·2 answers
  • The Empire State building in New York City is one of the most recognizable buildings in the world. Jim works at a structural eng
    7·1 answer
  • Water covers approximately:
    5·1 answer
  • Which stem adaptation is most helpful in protecting a plant from disease
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!