1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
miss Akunina [59]
3 years ago
11

Four functions of proteins

Biology
1 answer:
Sati [7]3 years ago
4 0
1) Enzyme activity
2) Cell to cell recognition
3) Cell signalling
4) Transport Materials.

Hope this helps! :)
You might be interested in
Carbohydrates are converted to energy by the process of hydrolysis. True False
Margaret [11]
Carbohydrates are converted to energy by the process of hydrolysis it is true.

7 0
3 years ago
Read 2 more answers
Mitosis occurs in Body cells<br> which are _____?
Elanso [62]
The answer is that they are somatic cells
7 0
3 years ago
Question 12
icang [17]

Answer:

The brown anole (Anolis sagre) is a species of lizard native to Cuba that has been introduced into the southeastern United States. The range of brown anoles in the United States has been

expanding and they are now competing with native green anoles (Anolis

8 0
3 years ago
What would happen to the flow of energy in this ecosystem if all the grasshoppers disappear
Nimfa-mama [501]

Answer:

Answer: The grasshoppers are the herbivorous insects.

Explanation:

These insects feed on leaves and grasses. ... The population of predatory birds, snakes and other animals feed on grasshoppers. If the grasshoppers become suddenly extinct, then the population of higher organisms will also decline in number or even extinct.

7 0
3 years ago
1.Wymień środowiska życia mchów.
Tresset [83]

Answer:

sadasdasdadsaaaaaaaaaaaaaaaaaaaaaaaaaaaa

Explanation:

7 0
4 years ago
Other questions:
  • What explains how buffere help cells to maintain homeostasis
    15·1 answer
  • Which of the following statements is FALSE
    8·1 answer
  • .
    15·2 answers
  • Sperm whales an species maintain their populations close to carrying capacity .
    12·2 answers
  • Why is nitrogen essential to life
    8·1 answer
  • What are the waste products of respiration
    14·2 answers
  • In the U.S. the fossul fuel that is present in the largest amount is
    15·1 answer
  • Which function does a neuron perform in a human body?
    14·1 answer
  • Confined aquifers are found _____.
    13·2 answers
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!