Plant absorb nitrogen gas from bacteria in the soil
Hello there,
Food,water,living space and disease examples of <u><em>The density dependent factors.</em></u>
Hope this helps!!!!
The answer would be C
The illness doesn't have to be life-threatening to the point where they must go to the hospital, but it could still be a health risk.
The statements that are correct concerning human DNA are it does contains 46 chromosomes and each strand contains chromosomes from one parent. There are 23 matched pairs of homologous chromosomes that make up the 46. One chromosome in each pair will be from a mother and the father.
It should be
AGATACCATGGTTACCCGGTTCCA
