1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aleksklad [387]
3 years ago
10

Start the rock's journey anywhere you want, but be sure to have it go through all the processes of the rock cycle by the end of

your story.
Biology
1 answer:
Nitella [24]3 years ago
8 0
Hiya,

Not sure how to answer this! Perhaps there is an image of the question or a lab you can attach to your question/comment so I can help you out? 

Thanks.
You might be interested in
what is an environmental concern regarding genetically modified plants that are resistant to herbicides and the other similar pl
FrozenT [24]

Answer:

Biodiversity Loss

5 0
2 years ago
The circulatory system is responsible for:
butalik [34]

Answer:

a transporting material throughout the body

3 0
3 years ago
Read 2 more answers
A nurse is preparing to auscultate a client's abdomen for the presence of bowel sounds. which is the appropriate action of the n
BaLLatris [955]
Have the client recline.

Warm the diaphragm of the stethoscope.

Place the diaphragm lightly in the right lower quadrant (RLQ) and listen for clicks or gurgles.

Move the chest piece over all four quadrants in a clockwise pattern.

Document the frequency and character of the bowel sounds.

Note the softness or firmness of the abdomen and feel for palpable masses.
8 0
4 years ago
What kind of soil is best for growing plants
Bingel [31]
A fertile soil is best for growing plants
4 0
4 years ago
How many valence electrons does a carbon atom have?
Kay [80]
A carbon atom has 4 valence electrons
7 0
4 years ago
Read 2 more answers
Other questions:
  • What helps create the spin in a hurricane?
    10·1 answer
  • A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
    14·1 answer
  • Which is the most likely last stage in a growth cycle? movement death birth reproduction
    8·2 answers
  • When seeds germinate, roots grow downward and stems grow upward in response to gravity. this response to gravity is called _____
    8·2 answers
  • A student was given a task to observe a bacterial specimen made from dilute yogurt and sketch the shape of bacteria seen. He dre
    10·2 answers
  • Some peeled peices of apple were placed in distilled water and some in very salty water. The cells in the apple peices will
    9·1 answer
  • Sales taxes collected by a retailer from a customer are expenses. True or False
    13·2 answers
  • Which of these events happended first?
    6·1 answer
  • In all what caused the earths temperature to rise by 10 degrees??​
    6·1 answer
  • Click on my profile picture and guess what Pokémon it is.
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!