1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Leto [7]
3 years ago
5

I need help. Due today.

Biology
1 answer:
Brums [2.3K]3 years ago
6 0

Answer:

D) common ancestry among vertebrate species

You might be interested in
What is the difference between shifting cultivation and land rotation?​
dsp73
Monoculture involves crop rotation as one of its elements.
7 0
3 years ago
when the bladder contains 400 to 500 ml of urine, this is referred to as specific gravity. anuria. renal clearance. functional c
ExtremeBDS [4]

A bladder containing 400 - 500 ml of urine is referred to as functional capacity.

Urine is defined as excess liquid waste products of metabolism in human as well as other animals. The kidneys filter nitrogen rich human metabolism byproducts such as urea and creatinine from blood, then transport it to the ureters, then the urine is excreted from the body via urethra. In order for micturition (a process of excretion of urine from the bladder) to happen, the bladder must maintain a functional capacity at a level of 400 - 500 ml of urine stored inside it, after which the excess level of liquid will be excreted from the body.

To learn more about urine visit: brainly.com/question/21951089

#SPJ4

4 0
1 year ago
You are traveling across the Pacific Ocean when you come across a small island, island #1. There is lush vegetation and several
Sauron [17]

Answer:

The correct answer is (a). The brown beetle migrated to island #1 and gave rise to the colored species on island #2 through adaptive radiation.

Explanation:

As there are no brown beetles on the island 1, and island 2 has less biodiversity of plants, it's possible to think that the brown beetle migrated to island 1 where there are many kinds of different plants, which would lead to the adaptation of these organisms resulting in many different species.

7 0
3 years ago
Axons of the nervous system are described as afferent and efferent according to the direction in which they carry information. W
Ahat [919]

Answer:

The correct option is b) motor output of the spinal cord

Explanation:

Motor neurons, also called afferent neurons, drive impulses from the brain and spinal cord to the receptors (eg, muscles). They are the motor output component of the spinal cord.

The spinal cord is a cord of nerve tissue that runs inside the spine. It conducts the nerve impulses that arrive from the receptors to the brain, and the responses with the motor orders from the brain to the effector organs. Thus, the brain receives the information and can develop an order that modifies the reflex response given by the spinal cord. A spinal nerve has two nerve roots: a motor and a sensory root. The motor root has nerve fibers that carry signals from the spinal cord, to the muscles to stimulate contraction and produce muscle movements, the fibers are efferent as they leave the medulla to the periphery through the anterior roots of the spinal nerves.

5 0
4 years ago
Ype the correct answer in the box. Spell all words correctly. What is the process of using natural resources efficiently to ensu
Marat540 [252]

Answer:

The correct answer is - Sustainable development.

Explanation:

Sustainable development is the process of using or utilizing the natural resources in the present in such an efficient way that there will be resources for future generations without compromising their needs.

It is essential in the current situation as people overexploiting the natural resources that it is quite possible there will very few resources will be left for future generations.

5 0
3 years ago
Other questions:
  • What are the two very important things that we get out of photosynthesis?
    9·1 answer
  • What is the primary learning modality of a child who learns best by looking at books and pictures?
    13·2 answers
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • Many northern hemisphere birds respond to seasonal environmental changes by
    11·1 answer
  • PLEASE HELP BIG TIME PLZZ
    12·1 answer
  • How does deposition change Earth's surface?
    5·1 answer
  • . What is the relationship between an enzyme and the substrates it can bind? 
    13·1 answer
  • This study is replicated in the Appalachian Mountains with similar results. Which of the following is true? The number of days w
    6·1 answer
  • What structure prevented the red onion cell from swelling up and bursting when they were placed in water?
    5·1 answer
  • Whats the correct answer answer asap for brainlist
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!