The answer is "A hypothesis is tentative statement" and "A theory has a strong predictive power."
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
The kelvin is the primary unit of temperature measurement in the physical sciences, but is often used in conjunction with the degree Celsius, which has the same magnitude. The definition implies that absolute zero (0 K) is equivalent to −273.15 °C (−459.67 °F).
The correct answer is - temperate rainforests of the Olympic Peninsula.
The Pacific northwest tree octopus is a fictional animal, thus it does not exist in the present, nor there is any proof that such a creature existed in the past, though there's every chance that it can evolve in the future.
According to the description of this fictional octopus species, unlike the octopuses we know, it is actually amphibious. This basically means that this octopus is able to live in the water, but also be terrestrial. It has developed from the octopuses in the East Pacific, and it started mostly to live on land, or rather on trees. It has used its eight tentacles in order to be able to have a perfect tool and easy arboreal life, swinging from one branch to another, being able to cover longer distances very easily, and manage to hunt with relative ease.
