1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
djyliett [7]
3 years ago
15

Crossing over occurs when

Biology
2 answers:
Svet_ta [14]3 years ago
3 0
Correct answer:
"<span>B- homologous chromosomes join together to form tetrads during prophase I"

</span>It is during prophase I that homologous chromosomes join together (<span>synapsis)</span> and form tetrads - four chromatids are together in the new structure of two chromosomes - and this is the reason why crossing-over occurs in this phase. It is in this tetrad that both arms of both chromosomes may crossover and matching regions exchange places. This process results in homologous chromosomes recombination leading to genetic variability. 
I am Lyosha [343]3 years ago
3 0

The correct answer is B: homologous chromosomes join together to form tetrads during prophase I

You might be interested in
What are the sources of genetic variation during Meiosis?
aniked [119]

Explanation:

Genetic variation is increased by meiosis

Because of recombination and independent assortment in meiosis, each gamete contains a different set of DNA. This produces a unique combination of genes in the resulting zygote. Recombination or crossing over occurs during prophase I

7 0
3 years ago
What is biology chemistry physic
Yuri [45]

hemistry is the "scientific study of matter, its properties, and interactions with other matter and with energy". ... It is an experimental science in which theories are developed and tested against observations. The goals of physics include explaining and predicting how the universe works. Biology is the study of life.

5 0
3 years ago
Read 2 more answers
How are spores structurally different from seeds?
AfilCa [17]
Spores are small single cell structures that are capable of growing into new organisms under the proper condition
<span>Seeds reproductive structures of more than one cell</span>
5 0
3 years ago
What type of cell is mostly square or rectangular shaped? *
Ganezh [65]

Answer:

It would be >> C plant cells

4 0
3 years ago
Is poverty or affluence a bigger issue moving forward? Discuss the pros and cons of<br> each.
Arturiano [62]
Poverty

have a good day
3 0
3 years ago
Other questions:
  • During exercise, muscle cells release the protein ________ which can cause brite/beige adipocyte formation:
    9·1 answer
  • Why do the cells of plant roots generally lack chloroplasts ?
    9·1 answer
  • True or false solid and liquid particles are also present in the atmosphere
    12·2 answers
  • Which characteristic is common to all prokaryotes and eukaryotes?
    10·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Based on this information how should the organism be classified
    11·1 answer
  • Winds blowing across the ocean surface cause friction which results in
    6·2 answers
  • How are embryonic stem cells and adult stem cells similar and different?
    7·1 answer
  • Which of the following predictions is most likely consequence of the mutation?
    8·1 answer
  • How many fertilized eggs naturally don’t implant in the uterus, but they pass out of your body during your period?.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!