I would have to go with A
Homozygous means "the same" and Heterozygous means "different". If a pheno type is homozygous, for example, it could be XX or xx, while heterozygous could be Xx. Hope that helps.
Here are some of the animals that have names that start with S: seal, sheep, skunk, sloth, sparrow, squirrel, swan, salamander, scorpion, serval, snake, spider, stork, etc.
Hope this helps :)
Answer:
Joint - a joint is where two bones articulate
In this case, the femur and tibia form a joint.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
