All categories

3 years ago

Plzzzzzzzzzzz answer

Biology

1 answer:

MatroZZZ [7]3 years ago

6 0

A)the monomers that make up proteins are amino acids( you could talk about the central dogma here but idk if you have to). remember central dogma is dna to mRNA then mRNA to amino acids and amino acids to proteins.

nucleic acid is made of the monomers nucleotides ( cytosine, thymine, adenine, and guanine). this is basically DNA

You might be interested in

Enter the sequence of the DNA coding strand with a 5-3 polarity. DO NOT WRITE 5 OR 3 OR 5' OR 3' IN THE BOX!

Charra [1.4K]

Complete question:

Use the sequence below to answer the following questions

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’

5’-TGCCTAGGAGGGATCACGCATTATGC-3’

1. Enter the sequence of the coding strand with a 5’-3’ polarity

Answer:

coding strand → 5´- GCATAATGCGTGATCCCTAGGCA -3´

Explanation:

When referring to the coding strand, we are talking about the sequence that turns to be the same as the mRNA that results from the transcription of the same DNI segment -switching bases T for U-.

The coding strand receives that name because it is the sequence that codes for each amino acid composing the proteins.

When the DNI molecule separates into two strands to form the transcription bubble, we can identify two separate segments: coding strand and template strand.

The coding strand goes in direction 5´ to 3´, while the complementary strand -template strand- grows in direction 3´ to 5´.

Whenever we have a DNI molecule and we need to determine which strand is the coding one, we just need to look for the presence/absence of start or stop codons.

So, in the exposed example we have two strands, but we do not know yet which one is the coding one.

Conventionally, the first strand is always the coding one. However, let us analyze it by using the presence/absence of codons.

First-strand:

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’

let us write it is 5´to 3´direction

5´- GCATAATGCGTGATCCCTAGGCA -3´

now let us identify the start and stop codons in 5´⇒3´direction.

Start codon ⇒ ATG
Stop codon ⇒ TAA, TAG, TGA

5´- GCATAATGCGTGATCCCTAGGCA -3´ ⇒ 1 start codon at the beginning

5´- GCATAATGCGTGATCCCTAGGCA -3´ ⇒ 3 Stop codons

Second strand: We will do exactly the same procedure

5’-TGCCTAGGAGGGATCACGCATTATGC-3’⇒ 1 start codon near the end

5’-TGCCTAGGAGGGATCACGCATTATGC-3’⇒ 1 stop codon at the beginning

What we did here was to identify in both provided strands, where the start and stop codons are placed. We can see that in the first strand we have the start codon near the beginning, while in the second strand we have it near the end of the sequence. From this information, we can assume that the first strand is the coding one. However, you need to know that some coding sequences do not have start and stop sequences, because they might correspond to a sequence in the middle of a gene.

So, the sequence of the DNA coding strand with a 5-3 polarity is

5´- GCATAATGCGTGATCCCTAGGCA -3´

8 0

3 years ago

Which of the following statements does not describe a problem with modern landfills? A. Materials buried in landfills decompose

Novay_Z [31]

The answer is D.................

5 0

3 years ago

_____ is an inquiry process that begins with a theory, prediction, or general principle that is then tested through data collect

Fantom [35]

Answer:

The deductive reasoning is an inquiry process that begins with a theory, prediction, or general principle that is then tested through data collection.

Explanation:

Deductive reasoning or logic is the reasoning mechanism from one or more statements in order to draw a logically definite inference. Deductive reasoning moves in the same direction as conditional reasoning and connects assumptions to judgments.

Both inductive and deductive reasoning aspire to build a reasonable argument. Inductive reasoning thus jumps from specific instances to a generalized conclusion, while deductive reasoning steps from generalized concepts, which are regarded to be accurate to a real and specific assertion.

4 0

3 years ago

Name two Indian Cow breeds And one foriegn breed. 100 POINTS !!!

Gala2k [10]

HEYA!!!!

The answer to your question is

Two Indian Cow Breeds are ;

Hallikar
Hariana Cattle

Foreign Breeds:-
Brown Swiss

Hope it helps you.

:)

7 0

3 years ago

Read 2 more answers

In which step of protein synthesis does the rRNA make protein?

Inessa [10]

Answer:

Translation is the second part of the central dogma of molecular biology: RNA → Protein. It is the process in which the genetic code in mRNA is read to make a protein. Translation is illustrated in the diagram below. After mRNA leaves the nucleus, it moves to a ribosome, which consists of rRNA and proteins.

Explanation:

Within the ribosome, the rRNA molecules direct the catalytic steps of protein synthesis — the stitching together of amino acids to make a protein molecule. In fact, rRNA is sometimes called a ribozyme or catalytic RNA to reflect this function.

8 0

2 years ago