1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
suter [353]
3 years ago
13

5. Membrane receptors are specialized proteins that take part in communication

Biology
2 answers:
joja [24]3 years ago
8 0

Answer:

The E zone portion of the protein

Explanation:

The glucagon hormone which is a signal molecules that triggers a reaction in the liver cells is most likely to bind to the E zone extracellular portion of the G-protein-coupled receptor. This then changes the conformation of the receptor activating the heteromeric G proteins.

FromTheMoon [43]3 years ago
7 0

Answer:

The E zone portion of the protein

Explanation:

You might be interested in
The rodent entorhinal cortex contains neurons that are known as ___________.
ruslelena [56]
D. somatosensory cells
5 0
3 years ago
A student with a common cold sneezes onto a facial tissue, throws it into a wastepaper basket, but misses, and the tissue falls
LekaFEV [45]

Answer:

d and c

Explanation:

hope im correct b.t.w plz help me at brainly.com/question/23664340

5 0
3 years ago
True or false there are no archaea that hurt humans as far as we know
ololo11 [35]

Answer:false

Explanation:idk

7 0
3 years ago
Read 2 more answers
As the population of snowshoe hares increases, what happens to the coyote and lynx populations?
Nastasia [14]

As the population of the hares increase, the coyote population increases as they have more food to eat.

7 0
2 years ago
Blue green algae multicellular or unicellular​
Ainat [17]

Answer:

Explanation:

Unicellular or multicellular, most cyanobacteria are a characteristic blue green, but can also be green, brown, yellow, black, or red.

4 0
3 years ago
Other questions:
  • In the female body, each egg is surrounded by a ____, which breaks open when the egg is mature.
    13·1 answer
  • Use the drop-down menus to complete the sentences.
    12·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Which terms is a process that is made up of two other term
    5·1 answer
  • How do humens get energy food or working out
    12·2 answers
  • In addition to natural factors, human activity can also alter ecosystems. Conduct research on a human activity that currently af
    14·1 answer
  • All you need to know is in the pic below
    15·2 answers
  • What are the building blocks of all organisms?
    11·1 answer
  • J'aurais besoin d'aide pour ce devoir de SVT 2nd
    13·1 answer
  • Blood Blood has four main components:Plasma is a straw-colored fluid. It is about 90 percent water and 10 percent dissolved gase
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!