1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bearhunter [10]
2 years ago
15

What will happen to the rate of

Biology
2 answers:
MissTica2 years ago
8 0

The answer is B. Not A or C. B. Now go get it right

Oksanka [162]2 years ago
3 0

Answer: B. The rate will decrease and eventually stop.

Explanation:

You might be interested in
When two or more substances are so evenly mixed that you can't see the different parts.?
Volgvan
Its a homogeneous mixture
4 0
2 years ago
Which organism is able to make its own oxygen gas?
NeTakaya

Answer:

cyanobacteria

cyanobacteria  is The answer is tiny organisms known as cyanobacteria, or blue-green algae. These microbes conduct photosynthesis: using sunshine, water and carbon dioxide to produce carbohydrates and, yes, oxygen

Explanation:

Hope this helps:)

8 0
2 years ago
Read 2 more answers
The parietal cells of the stomach secrete ______________, while the chief cells secrete ______________.
babunello [35]

Explanation:

The two main types of exocrine secretory cells of the stomach are parietal cells and chief cells. Parietal cells secrete hydrochloric acid and chief cells secrete digestive enzymes such as pepsin

7 0
2 years ago
2) Explain the relationships among an organisms <br> environment, adaptations,<br> and evolution.
seropon [69]

Answer:

Organisms are part of an environment and are continually adapting to the changes to live. These environmental changes and the adaptation play a major role in evolution of organism.

Explanation:

5 0
3 years ago
The type of bond that forms between water molecules, and contributes to cohesion is a(n)? peptide bond. ionic bond. hydrogen bon
ser-zykov [4K]
It is an ionic bond that forms.
4 0
3 years ago
Read 2 more answers
Other questions:
  • What is made up of the brain and spinal cord?
    6·1 answer
  • Is nucleus transparent or are the dots things nucleus? What does chloroplast do?
    14·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • If two glasses of water are at the same temperature, what do you know about the kinetic energy of the particles in the glasses o
    15·1 answer
  • The hypothalamus, which is involved in maintaining steadiness of bodily functions, the hippocampus, which is involved in memory,
    10·1 answer
  • What are isotonic, Hypotonic and Hypertonic solutions??
    10·1 answer
  • What transport method do you think the Golgi apparatus uses to ship packages of proteins out of the cell?
    12·1 answer
  • If anyone could give me the answers to these two please help
    14·1 answer
  • Need helpwith this question plzz
    15·2 answers
  • In three to five sentences, explain why recyclable does not necessarily equate to renewable. Give examples to support your expla
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!