1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
avanturin [10]
3 years ago
5

A merchant bought 30 dozen pairs of gloves how many individual gloves did the merchant buy

Mathematics
1 answer:
nordsb [41]3 years ago
3 0

My best guess would be 720.


My work: 30 x 12 = 360

360 x 2 = 720


Hope this helps! If its not right please inform me on what I did wrong!

You might be interested in
Determine the intercepts of the line <br> Y ——-,——-<br> X——-,——-
77julia77 [94]

Answer:

(-8,0), (0,-6)

Step-by-step explanation:

3 0
3 years ago
The question is *what is the solution to to this system of equations* I need help on this pleaseee
Sladkaya [172]

Answer:

(2,2)?

Step-by-step explanation:

I just looked at the point that they intersected at.

7 0
3 years ago
This is my stuff cow &lt;3
pav-90 [236]

Answer:

(⌐■-■) ..................

8 0
3 years ago
Read 2 more answers
In which choice is
____ [38]
I think the answer is C
7 0
3 years ago
$80 printer selling for 37.5% off find the final price of the printer if the sales tax is 5.5%
julia-pushkina [17]
$51.65 would be your answer. Happy to help ☺️
8 0
3 years ago
Read 2 more answers
Other questions:
  • Refer to the figure to complete the proportion A/C = Y/?
    14·1 answer
  • How many digits of Pi had the Guinness World Record holder memorized?
    10·2 answers
  • T took Mr. Phillips 1.6 hours to run the 13.2 miles. What was his average speed? *
    8·2 answers
  • What is the value of the inverse shown below? S –1 (0) =
    12·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • a rectangle has a length that is 5 inches grater than is width and is area is 104 square inches, The equation (x+5) x=104 repres
    12·1 answer
  • Please help WILL GET REPORTED IF ANSWERS NONSENSE FOR POINTS I am really struggling and need help It is a lot of points so try a
    11·1 answer
  • The slope formula can be used to find the slope, m, of a line with points (L1, y1) and (22, 42).
    7·1 answer
  • HELP ME THIS MY LAST QUESTION PLEASE!!!!!!!!!!!!!!!!!!!!!!!
    7·1 answer
  • Your history test is out of 30 points. How many points would you need to get if you wanted a ‘B’ or higher? (Hint: A grade of 80
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!