1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Novosadov [1.4K]
3 years ago
12

Mechanism of double fertilization

Biology
1 answer:
Sunny_sXe [5.5K]3 years ago
4 0
One sperm fertilizes the egg cell forming a diploid zygote, the other sperm fuses with the two polar nuclei forming a triploid cell that develops into endosperm 

You might be interested in
Where is most of the ATP made during cellular respiration?
aniked [119]

Answer:

Mitochondria

Explanation:

Most of the steps of cellular respiration take place in the mitochondria. Oxygen and glucose are both reactants in the process of cellular respiration. The main product of cellular respiration is ATP; waste products include carbon dioxide and water.

Hope that answers your question.

8 0
3 years ago
43 protons, 55 neutrons, and 44 electrons. What is the charge of the atom’s nucleus?
Lostsunrise [7]

Answer:

23

Explanation:

Took the test got a 100%

6 0
3 years ago
transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
tino4ka555 [31]

Answer:

AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG

Explanation:

this is the complementary strand for the mRNA.

A=U

C=G

G=C

T=A

this is the key for any mRNA strand.

;)

3 0
3 years ago
How do you see the stars? If your vision is clouded by darkness?
-BARSIC- [3]

Answer:

When you see stars inside the eye, you may be experiencing what's called an entoptic phenomenon. ... They're actually little clumps of vitreous gel floating inside your eye. Sometimes they can be caused by other conditions, including: tears or holes on the retina...

The primary causes of blurred vision are refractive errors — nearsightedness, farsightedness and astigmatism — or presbyopia. ... Cloudy vision usually is a symptom of specific conditions such as cataracts. Blurry vision and cloudy vision both can be symptoms of a serious eye problem, especially if they occur suddenly.

3 0
3 years ago
Dr. Poole noticed a high proportion of tuskless elephants after the war. But why did males still have their tusks?
Crazy boy [7]

Answer:

Dr Poole worked in Gorongosa park and he made the observation of most females being tuskless as a result of the selective pressure caused by poaching.

Although male elephants are also affected by this in which some don’t also have tusks the percentage is low when compared to the female elephants.

5 0
3 years ago
Other questions:
  • What are some adaptations of insects and arachnids?
    7·1 answer
  • what is the function of the noun phrase green, leafy vegetables in this sentence? green, leafy vegetables contain important vita
    12·2 answers
  • The outermost layer of earth is called the mantle t or f
    5·2 answers
  • When viewed through a microscope, one characteristic of living cells is that their internal structures move. what organelles are
    15·1 answer
  • which of the following steps is an important part of the process by which energy guides human to a sustainable future A) behavio
    14·2 answers
  • Plants use different structures and processes to create offspring. Sphagnum spp. is a type of moss typically found in peat bogs.
    14·1 answer
  • Each cell is surrounded by a _____ that seperates the interior of the cell from its surroundings
    5·2 answers
  • As water changes state the water either obsorbs or releases energy. Which of these answers is a process that releases energy?
    12·1 answer
  • What is an amino acid?
    11·1 answer
  • Why human cell is consider as eukaryotic cell where as bacteria cell as prokaryotic cell?​
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!