1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zielflug [23.3K]
3 years ago
13

Answer asap please??

Mathematics
1 answer:
natali 33 [55]3 years ago
7 0
Its c btw have a good way
You might be interested in
Explain how to solve the equation and then check the solution.<br><br> 9 = q – 4
Vika [28.1K]

Assignment: \bold{Solve \ And \ Check \ Equation: \ 9=q-4}

<><><><><><><>

Answer: \boxed{\bold{q=13}}

<><><><><><><>

Explanation: \downarrow\downarrow\downarrow

<><><><><><><>

[ Step One ] Switch Sides

\bold{q-4=9}

[ Step Two ] Add 4 To Both Sides

\bold{q-4+4=9+4}

[ Step Three ] Simplify

\bold{q=13}

[ Step Four ] Check Your Work

\bold{13 \ - \ 4 \ = \ 9}

[ Step Five ] Question: Is Equation Correct

\bold{Equation \ Is \ Correct, \ Therefore \ q=13}

<><><><><><><>

\bold{\rightarrow Mordancy \leftarrow}

5 0
4 years ago
Read 2 more answers
Can someone help me please
11111nata11111 [884]

Answer:

tem

Step-by-step explanation:

3+1=10

3 0
3 years ago
Read 2 more answers
Simplify: 8^2 + 9(12 / 3*2) -7
Naily [24]

Answer:

357 / 2

Step-by-step explanation:

your answer would have been 178.5 but just a reminder always do whats in the exponets

5 0
3 years ago
Suppose that there are two types of tickets to a show: advance and same-day. Advance tickets cost and same-day tickets cost . Fo
AveGali [126]

Answer:

83746+4747+48484=3943848343

Step-by-step explanation:

Easy

8 0
2 years ago
How do you do -19+C/3=8 can someone teach how to solve this problem?
ki77a [65]
You're looking for c, so you want to isolate it or get it by itself. To get rid of the /3 you multiply since the opposite of division is multiplication and to get rid of it, you do the opposite (like -9 you would add 9 to get it to 0). Now you are left with -19+c = 24 (the 24 is 8*3 because what you do to one side you do to the other. Now you get c by itself so you add 19 to both sides which leaves you with C= 43. Sorry if this was confusing!
3 0
4 years ago
Other questions:
  • A savings account deposit of $300 is to earn 5.8% interest. After how many years will the investment be worth $900?
    11·1 answer
  • A company is experimenting with two new boxes for packaging merchandise. Each box is a cube with the side lengths shown. (smalle
    6·2 answers
  • Allie has punch cards for her favorite tea house and her favorite coffee shop. She currently has 9 punches on the tea punch card
    13·1 answer
  • Cora chose to have her birthday party
    12·1 answer
  • Explain how you could use a number line to determine the number. Also, determine the number.
    10·1 answer
  • Circle the integer(s) that have an absolute value of 11
    7·1 answer
  • What is the product?<br> 3 x [-4 5 -7]
    12·1 answer
  • Q22.
    10·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Figure A is a scale image of Figure B.<br><br> What is the value of x?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!