1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kvasek [131]
3 years ago
11

What do scientists now think about the basis of life

Biology
1 answer:
mariarad [96]3 years ago
7 0

<u>ANSWER:</u>

Scientists are now of the opinion that life originated from inorganic molecules.

<u>EXPLANATION:</u>

  • Scientists now think that "life on earth" originated around 3.5 to 3.9 million years ago.
  • According to scientists, "building blocks of life"(amino acids) were first formed and these combined to form the compounds essentially needed for life on earth.
  • There are many scientists who also think that the first organic molecules on earth came from meteorites.
  • There are however many scientists who also think that some of the "building blocks of life" may have been formed abiotically on earth.
You might be interested in
Consider the statement "We are fish to a cladist." A cladist is someone who only recognizes groups descended from a common ances
kolezko [41]

Answer:

B. polyphyletic group

Explanation:

Polyphyletic group is a taxon which comprises of organisms which are unrelated and do not share a recent or immediate common ancestor. Polyphyletic group is often used to refer to a group of organisms with similar characteristics called homoplasies, but not inherited from  a common ancestor. This means that the organisms are of multiple origins irrespective of the traits that make them similar.

Therefore, from the question, because we do not consider ourselves fish, we would describe the group "fish" as polyphyletic.

8 0
3 years ago
What is anemophroia,hydrochoria,anthropochoria and zoochoria?​
Juliette [100K]

Answer:

also known as anemophobia, is an extreme fear of wind or drafts. It is rather uncommon, and can be treated. It has many different effects on the human brain. It can cause panic attacks for those who have the fear, and can make people miss out on regular everyday activities such as going outside.

In chemistry, a hydrochloride is an acid salt resulting, or regarded as resulting, from the reaction of hydrochloric acid with an organic base. An alternative name is chlorhydrate, which comes from French. An archaic alternative name is muriate, derived from hydrochloric acid's ancient name: muriatic acid.

Meaning of zoochoria in the Polish dictionary with examples of use. Synonyms for zoochoria and translation of zoochoria to 25 languages.

Anthropochore definition is - a plant that is regularly distributed by humans whether deliberately (as crop plants) or accidentally (as weeds).

Explanation:

8 0
3 years ago
Mexico's physical geography is made up of __________. A.llanos and pampas B.small continental pieces carried from the Caribbea
yawa3891 [41]
High central plateaus sandwiched between tall mountains
3 0
3 years ago
All the following are incentives for individuals to start using more efficient fuels EXCEPT:
Nat2105 [25]
The answer you're looking for is C
5 0
3 years ago
The gonads are reproductive organs responsible for the production of
ASHA 777 [7]

Answer:

The gonads are reproductive organs responsible for the production of <u>gametes (sex cells) in their external secretion and in their internal secretion, hormones that exert their action on the organs involved in reproductive function.</u>

Explanation:

Gonads are glands that are part of two body systems: the endocrine system and the reproductive system; and there are two types of gonads: male and female, the first are the testicles and the second the ovaries and both produce steroid hormones (derived from cholesterol) exactly the same as those produced by the cortex of the adrenal glands.

8 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Do plants grow better with classical music?
    15·2 answers
  • Genes are important in determining what you look like. what else plays an important role?
    15·2 answers
  • Which of these events breaks down rocks into smaller pieces? (4 points) Sedimentation Deposition Weathering Erosion​
    12·1 answer
  • When you spin around, you lose balance because of fluid spinning around in the _____.
    10·2 answers
  • Air and water pollution result manly from what?​
    6·1 answer
  • How are atoms in sugar molecules used to form amino acid and other large carbon-based molecules?
    8·1 answer
  • 50 POINTS!!!! Which result is a predicted result of the melting of the world's ice sheets?
    13·1 answer
  • What happens when humans burn fossil fuels?
    6·1 answer
  • How is this fresh water animal like a plant? what do you think makes it not a plant?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!