Rabbits tend to wander a lot and if it runs into weed or grass... well it eats it. eating weed or grass allows rabbits to gain more energy. if the supplies of grass and or weed increases the population of rabbits would increase too. the more they eat the more energy the have and the more energy the have the more they reproduce.
more power = more reproduction
more reproduction = increase in population
so all in all the more weed, the better it is for rabbits since the amount of food increases
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
Explanation:
Thus, the first equation to consider simply shows that the change in the number of individuals in a population in a given time interval is the population growth rate
Linda’s belief in her capabilities is known as self-efficacy.
<u>Explanation:</u>
The concept of self efficacy was proposed for the first time by psychologist Albert Bandura. According to him self –efficacy means the ability of a person to execute courses of action that are required to deal with prospective situations. Self-efficacy determines the power of a person to face challenging situations and the choices he or she makes in life.
An individual’s external experiences and self perception are crucial in the development of self-efficacy. People with high self-efficacy tend to give a try in mastering even the hardest tasks rather than trying to avoid them.