1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mel-nik [20]
3 years ago
15

Which plant structure is the dominant sporophyte of angiosperms?

Biology
2 answers:
Elenna [48]3 years ago
5 0
Flowers are the <span>plant structure that is the dominant sporophyte of angiosperms.</span>
swat323 years ago
4 0
Flowers is the best result for this type of plant
You might be interested in
If there were more weeds what would happen to the rabbits?
EleoNora [17]
Rabbits tend to wander a lot and if it runs into weed or grass... well it eats it. eating weed or grass allows rabbits to gain more energy. if the supplies of grass and or weed increases the population of rabbits would increase too. the more they eat the more energy the have and the more energy the have the more they reproduce.
more power = more reproduction
more reproduction = increase in population
so all in all the more weed, the better it is for rabbits since the amount of food increases
7 0
3 years ago
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
Which of the following describes a population
laiz [17]

Answer:

Explanation:

Thus, the first equation to consider simply shows that the change in the number of individuals in a population in a given time interval is the population growth rate

4 0
3 years ago
Linda has been hired by Doctor Patel to oversee a fast-paced, innovative medical office. It is a highly difficult, but well-paid
lozanna [386]

Linda’s belief in her capabilities is known as self-efficacy.

<u>Explanation:</u>

The concept of self efficacy was proposed for the first time by psychologist Albert Bandura. According to him self –efficacy means the ability of a person to execute courses of action that  are  required to deal with prospective situations. Self-efficacy determines the power of a person to face challenging situations and the choices he or she makes in life.

An individual’s external experiences and self perception are crucial in the development of self-efficacy. People with high self-efficacy tend to give a try in mastering even the hardest tasks rather than trying to avoid them.

8 0
3 years ago
Brown fur (F) is dominant over white fur (f) in rabbits. Cross a male heterozygous for brown fur with a white furred female. Wha
notka56 [123]

Answer: 2 Ff: 2 ff  

Male: Ff

Female: ff

5 0
3 years ago
Other questions:
  • What is a point of view influenced by an opinion
    11·1 answer
  • Pathology examination of tissue removed during a pancreas biopsy. report code _____.
    14·1 answer
  • Tea is a drug that blocks nicotinic acetylcholine receptors. applying this drug would most likely inhibit:
    9·1 answer
  • I don’t know how to answer this question
    12·2 answers
  • The sun's energy comes from
    9·1 answer
  • What is difference between MYOCARDIAL INFRACTION and ANGINA PECTORIS ?
    8·1 answer
  • How are trace fossils unique
    9·1 answer
  • Which organism will most likely produce soil first
    12·1 answer
  • Place the following in the correct order as they occur in CELL RESPIRATION.
    6·1 answer
  • What is the maximum number of hydrogen atoms that can be covalently bonded in a molecule containing two carbon atoms? a. Two.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!