All categories

2 years ago

If all cells contain the same DNA, how does the function and appearance of cells differ?

1 answer:

3 0

These cells are different because they use the same set of genes differently. So even though each of our cells has the same 20,000 or so genes, each cell can select which ones it wants to “turn on” and which ones it wants to keep “turned off”
I hope this helps :))

You might be interested in

The process of change in a population over the thime is called?

qwelly [4]

Answer:

tramwayniceixand 1 otherlearned from this answer. Answer: 1. Micro-evolution is the change in allele frequencies that occurs over time within a population. This change is due to four different processes: mutation, selection (natural and artificial), gene flow and genetic drift. 2.

Explanation:

This change is due to four different processes: mutation, selection (natural and artificial), gene flow and genetic drift. 2.

5 0

3 years ago

Aaron has pre-hypertension. to help lower his blood pressure, he should consume foods that are high in

Anna [14]

Potassium and can be obtained by eating avocados, acorn squash, sweet potato, spinach etc..

4 0

3 years ago

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago

Which isn’t an example of a matrix in which organisms may become fossilized

Damm [24]

Answer:

where's the options for this question?

6 0

3 years ago

The bond that joins two monosaccharides into a disaccharide is a(n _____.

Nadya [2.5K]

It is an glycosidic bond.

6 0

3 years ago