1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Cloud [144]
3 years ago
10

Organisms that live in deciduous forests have developed unique adaptations that aid in their survival. Which adaptation would be

seen in the duckbilled platypus? a. The duckbilled platypus reaches an adult length of 3 to 4 feet. b. The duckbilled platypus lives near water. c. The duckbilled platypus gives birth to live young. d. Females have venom glands on a spur on their hind feet
Biology
2 answers:
padilas [110]3 years ago
8 0
The adaptation seen in the duckbilled platypus that would be aid in their survival is the D. females have venom glands on a spur on their hind feet. These venom glands aid them against predators.
levacccp [35]3 years ago
8 0

The correct answer is (b)The duckbilled platypus lives near water.

The duckbilled platypus is well adapted for the semi- aquatic lifestyle. They live in water and make burrows to stay safe from predators. They live near water to save themselves from the harmful predators. They have a streamline body that helps in swimming and a dense water proof fur to provide thermal insulation as there is fluctuation in temperature in deciduous forest.





You might be interested in
Which of the following is the most realistic goal for attaining better resilience?
Anettt [7]
<span>A.let myself feel sad and then find ways to move on</span>
8 0
3 years ago
Read 2 more answers
What is the number of codons needed to make an amino acid
Ugo [173]
You need three codons to make an amino acid. 
4 0
4 years ago
What is the orientation of the two unhybridized p orbitals on be with respect to the two be−f bonds?
olganol [36]
Each sp2<span> hybrid orbital on a carbon atom contains one electron. Figure 9.21 shows how the four C</span><span>H </span><span> bonds are formed by overlap of </span>sp2<span> hybrid orbitals on C with the 1</span>s<span> orbitals on each H atom. We use eight electrons to form these four electron-pair bonds. The C</span><span>C </span><span> bond is formed by the overlap of two </span>sp2<span> hybrid orbitals, one on each carbon atom, and requires two more electrons. The C</span>2H4<span> molecule has a total of 12 valence electrons, 10 of which form the one C</span>C and the four C<span>H </span><span> bonds.</span>
5 0
4 years ago
Read 2 more answers
Explain how structure x help a young axolotl survive as it grows
Butoxors [25]
Axolotl is a Mexican salamander or Abystoma Mexicanum.  It can survive as it grows through True Cellular Regeneration.  This  is the ability to regenerate cells, tissues and organs without the need of transplants.  T<span>he axolotl is unique in the sense that it can renew several structures like limbs, jaws, tail, spinal cord, skin throughout their lives. They can even receive transplanted organs from other individuals and accept them without difficulty.</span>
8 0
3 years ago
RNA: CATTGGCTAACGTCGATAATCGTCGGTAC
Ymorist [56]

Answer:

Amino acid sequence: Valine- Threonine- Aspartic acid- Cysteine- Serine- Cysteine- Stop.

Explanation:

This question is describing the process of translation, which is the second stage of protein synthesis. Translation is the process whereby a mRNA template is used to produce amino acids, which forms a sequence that will eventually become protein.

The mRNA sequence is read in a group of three nucleotides called CODON. Each codon specifies a particular amino acid. According to this question, using the genetic code table, the given DNA sequence is as follows:

DNA: CAT- TGG- CTA- ACG- TCG- ATA- ATC- GTC- GGT- AC

RNA = GUA- ACC- GAU- UGC- AGC- UAU- UAG- CAG- CCA- UG

Amino acid sequence: Valine- Threonine- Aspartic acid- Cysteine- Serine- Cysteine- Stop.

5 0
3 years ago
Other questions:
  • Why are protozoa significant? Select all that apply.
    5·2 answers
  • Henry was studying two populations of the same species of lizards. One population lived on an island and the other lived on the
    12·1 answer
  • Which statement best describes the weather shown by the red semicircle on a line on a weather map?
    7·2 answers
  • Erosion occurs when
    9·1 answer
  • Please help me and please no wrong answers.<br> How are gemstones classified?
    6·1 answer
  • Which of the following summarizes the endocrine system's role? Group of answer choices To carry nerve impulses throughout the bo
    7·1 answer
  • Need this for homework
    14·2 answers
  • WILL GIVE BRAINLIEST
    14·1 answer
  • Proteins are synthesized by cellular organelles called.
    15·1 answer
  • What form of life was developing on Earth 4500 million years ago?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!