I believe the biggest space mission of the twenty-first century will be a manned mission to Mars, and the colonization that follows. This is the stated goal of several nations, companies, and individuals, all with considerably deep pockets. This mission will not only be a huge leap forward in space exploration, it will usher in a new era in human history in which the human race is an interplanetary civilization, a natural milestone as humanity continues to progress and advance.
Significant challenges are many and overwhelming. In terms of getting to mars, we need efficient, powerful propulsion systems and a spaceship that can not only accommodate a full crew for a mission that would likely last years, but withstand the various hazards that a long trip through space and entrance into the Martian atmosphere will entail. In terms of colonization, significant challenges will include establishing efficient and frequent travel/transport between the planets, and in the longer term, the necessity to terraform the planet (make it more like Earth) so that humans can more easily live there.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Food is the most important source of chemical energy for living things. The chemical energy in food is converted, or changed, by the body into moving mechanical energy and heat energy. People have invented ways to use the chemical energy of substances to power machines.
Because people and animals exhale carbon dioxide which plants need and they release oxygen
PP: Purple
Pp: Purple
pp: White
These are the correct answers for this.
Hope this helps
