DNA- Deoxyribonucleic Acid is a molecule composed of two chains or double strands that coil around each other forming a double helix to carry the genetic information for the development of an organism.
<u>Explanation:</u>
- DNA contains the information that instructs a living organism to develop, grow, survive and reproduce.
- The information instructed is found inside every cell and is passed down from parents to their children.
- DNA is made of nucleotide molecules which in turn contains a phosphate group, a sugar group, and a nitrogen base.
- Deoxyribose in DNA is another form modified from ribose sugar.
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.
Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT
These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
The most observable difference is the way in which cytokinesis occurs. In plants a new cell wall is fashioned between the new daughter cells, while in animal cells the cell membrane constricts to pinch the parent cell into daughter cells.
If I remember that abiotic means not living then rocks, soil, air.
<span><span>C. descending order by weight. </span>The standard rule in food labeling guide is to list ingredients </span>in order of weight. The first ingredient being the one that weighs the most, and the last ingredient that weighs the least. Water should also be included in the list of ingredients unless it's less than 5 percent of the product.